POLYNUCLEOTIDES AND POLYPEPTIDES OF ADENOVIRUS

专利摘要:
The present invention relates to isolated polynucleotide and polypeptide sequences derived from the novel ChAd157 chimpanzee adenovirus, as well as recombinant polynucleotides, vectors, adenoviruses, cells and compositions comprising said polynucleotide and polypeptide sequences.
公开号:BE1025029B1
申请号:E2017/5910
申请日:2017-12-07
公开日:2018-10-10
发明作者:Virginia Ammendola；Stefania Capone；Stefano Colloca；Antonella Folgori；Rosella Merone
申请人:Glaxosmithkline Biologicals Sa；
IPC主号:

专利说明:

(30) Priority data:
12/09/2016 GB 1620 968.6 (73) Holder (s):
GLAXOSMITHKLINE BIOLOGICALS SA
1330, RIXENSART
Belgium (72) Inventor (s):
AMMENDOLA Virginia 80145 NAPLES Italy
CAPONE Stefania 80145 NAPLES Italy
COLLOCA Stefano 80145 NAPLES
Italy
FOLGORI Antonella
80145 NAPLES Italy
MERONE Rosella
80145 NAPLES
Italy (54) ADENOVIRUS POLYNUCLEOTIDES AND POLYPEPTIDES (57) The present invention relates to isolated polynucleotide and polypeptide sequences derived from the new chimpanzee adenovirus ChAdl57, as well as recombinant polynucleotides, vectors, adenoviruses, cells and compositions comprising said polynucleotide and polypeptide sequences.
Lf ·. >>>: · <; <<<<<< χ · '· χr; ·.' · - ·; · ; ··· .X s- s ·:.;.: X χ-χ>. χ
X χ, χχ.:, -: -: - :: - 5:.: -: - ·. ·. ··: ··· - ··· .'χ-χ: <χχ :: -; . · ..Χγ ·; ·; <. Χ.: · ::.> ; χ.; · .-; · χ: · Λ χ 5χ: ·: · χ: ·>: ·: ·: · :. ·: Χ: λ: · ::
, Χ-χ · :: ·. Xi Χ ·: - :::. Χ-Χ 5Χ-: ·:, · χ · x-i-xx-x; · :: · ; . ·; ·· -;: · χ χ <: ·:.: ·: · <<;;> Χ -.>: ···; :: '·· .-, -: ·: ·: ·>: ·> Χ · χχ ·· χ:> x ::. : - ··: · :;. ”: -. ·, ', -: - :: · .-. · Χ:
, · Χχχ 5χ5 Χ'χ5χ · 5χ5 Ν5γ5: ί,:; · χίχχ5χχ5γ · χχ · Λ: <, 5,>, 5-5 <Λ; ^ ζ.χ:, χ <,; 555χ .: .χ <«.; ο5.Λ-χ · 5χ: ·: χχχ
, ό XxxX SXi5X5SxiX <x.vY: Xx: 5S: Xex: -xc: χ> -, '5> χ, .χ <·: χχ55: χ.:. χ.: «. ·: ·: · 5χ ·! · Χ ·: Λ · ..: ··: <χ - :: ·: χ “χ ::
· : ·: · χ-χ ;. : -χ-: χ5χ.χ5; · χ <ν>: ·>: ·> χ <·: <- · <· χ: ·: ·· <·: ': ·: -χν <χ · χ ·: · Χ: χ · χ : Χ ·;. :: · χ> .; 5; ν5χ.: · ν.: Λ <· - ^ χ ·: ·; ”;. χ · χ <γ ·:
ί "χχ: · χ.: ·: - · .Χχ · χ ··; :: · ::: -: · χ · - ·: >>: ·· <- ·: · 555 : ·> χϊχχχ: χχχ: <·; · χχχ-χ. : .-: -.- χ '. ··; χ ·; · χ. · _.
::;: Χ :: χ; ·.:; ·; χχχχ-χίχ.χχ ·: · χ ·: χ: ·:. · χν ..: 1: -: -:.-.-: -:.: -. 5, :: -.: -: .-: : 55: -5:, · :: · ·: .-, χχ-:;. ::: χ · Χ '·: -: ·' ί55λ ·: · : ··· .-:.: · ; ·: ... · χ · <·: -χ: χχχ: · χ: · Χχ : ·: Χν57 · 5Λ <<'· χχχ · 55 χ55χ; γ: γχ 555555Χ! 5 & υ <: χ5 ^ Χ: υ: <·:;:> 1 · 5 $ 55:; · υ : «<·: χ 5χ ·· -.> χ : <·: · Χ ·: 5: <^ 5Χ5 <5 ™ -: · 5555 / 5555χχγ · χό Χ555χ <: ίΧXX-Χ. ·> .Χχχχχ. . ·> ^: Χ.χ5 ·:, ν,: - χ ·; ·:,. Χχ-χ: ί: ς: . '' Ϊ́ : Χ ', γχ · 5χ: ^: · 5: χ: ίΛ: <> χλ ·:.: · 7 <χ. '.:.: · 7ΧΛ. '.>':.·'.;.'χ · 7 . : ·· 5: ·> :: 5 :: ..-:.: -:.:.:.: ...:, - 35:.:.: - 55 .:: χ;
• X χ, ΧΧ χ: .χχ.'χ5χ.: <· 5χχχχ << ··: 5χχ ·> χ · .χχ: ·:.: 5>: · .χ ;
• XX ·. ·.!! Χ: χ: ·:: χ · χ: · χχ5: 5: .χχ ·: χ5: · 77.χχ <3: · χ>: χ ·: · '·' ΧΧ · Χ: ::; ν55-.χ.3: · 55χ.;. _; -χ, _χ,: ο · · 5Χ: θ5: Χ5Ο5Χ _'<Ζ: 5, χ. _; χςν,;.;;;. χ < _ί .χ ;. _: .;. χ>_; . _; , .. χ ^ _{> ν} . ;;. , _Λ. -Λ ^ ν. _ί ^ _Λ , - _{χ <} χ ,;
• · <5χ ··:>: · χί> ·: Χ: · Χχ: Χχ ·: ·: · 55χ.χ: 3: ·: -: ν: · :: · χ- · Χ · χ: · : · Χ ·: ν: · χ · ..χ: χχ :: · 5χ; ·: ν5χ, 5χ * χχ5Χ5; χ.Γ.χ5χ.χ> 5χ ^: Χ · Χ5: . Χ · χχ :; ":; · 5:;. 5; χ. ·; 5 · .5; <- υυ: λ; υ ·: κ.: <:: 'Χ755 · ." :::. 5: 5χ; :::: α, υχ.: 5 ^: ^ u- :;
- .MV .:, · ν • .'xîxxcxn-xiv'-xk '-' x-.axx-xyox.a-xv.s. -. ^ - 5 -.- 5555- Λ.- · :: '· ---: ”:. ·, ·.>:
•Fr. _ r ·. ·, -; · :: χχ ”<χ, χ.- _; χχ;, · :: ·
BELGIAN INVENTION PATENT
FPS Economy, SMEs, Middle Classes & Energy Publication Number: 1025029Filing number: BE2017 / 5910 Intellectual Property Office International Classification: C07K 14/075 C12N 15 / 861A61K 39/12 A61K 39/235Issue date: 10/10/2018
The Minister of the Economy,
Having regard to the Paris Convention of March 20, 1883 for the Protection of Industrial Property;
Considering the law of March 28, 1984 on patents for invention, article 22, for patent applications introduced before September 22, 2014;
Given Title 1 “Patents for invention” of Book XI of the Code of Economic Law, article XI.24, for patent applications introduced from September 22, 2014;
Having regard to the Royal Decree of 2 December 1986 relating to the request, the issue and the maintenance in force of invention patents, article 28;
Given the patent application received by the Intellectual Property Office on 07/12/2017.
Whereas for patent applications falling within the scope of Title 1, Book XI of the Code of Economic Law (hereinafter CDE), in accordance with article XI. 19, §4, paragraph 2, of the CDE, if the patent application has been the subject of a search report mentioning a lack of unity of invention within the meaning of the §ler of article XI.19 cited above and in the event that the applicant does not limit or file a divisional application in accordance with the results of the search report, the granted patent will be limited to the claims for which the search report has been drawn up.
Stopped :
First article. - It is issued to
GLAXOSMITHKLINE BIOLOGICALS SA, Rue de l'arstitut 89, 1330 RIXENSART Belgium;
represented by
PRONOVEM - Office Van Malderen, Avenue Josse Goffin 158, 1082, BRUXELLES;
a Belgian invention patent with a duration of 20 years, subject to the payment of the annual fees referred to in article XI.48, §1 of the Code of Economic Law, for: POLYNUCLEOTIDES AND POLYPEPTIDES
ADENOVIRUS.
INVENTOR (S):
AMMENDOLA Virginia, Via Gaetano Salvatore 486, 80145, NAPLES;
CAPONE Stefania, Via Gaetano Salvatore 486, 80145, NAPLES;
COLLOCA Stefano, Via Gaetano Salvatore 486, 80145, NAPLES;
FOLGORI Antonella, Via Gaetano Salvatore 486, 80145, NAPLES;
MERONE Rosella, Via Gaetano Salvatore 486, 80145, NAPLES;
PRIORITY (S):
12/09/2016 GB 1620968.6;
DIVISION:
divided from the basic request:
filing date of the basic application:
Article 2. - This patent is granted without prior examination of the patentability of the invention, without guarantee of the merit of the invention or of the accuracy of the description thereof and at the risk and peril of the applicant (s) ( s).
Brussels, 10/10/2018,
By special delegation:
BE2017 / 5910
POLYNUCLEOTIDES AND POLYPEPTIDES OF ADENOVIRUS
we of his Have very and of a the Genoa oa , r a
FIELD OF THE INVENTION
The present invention relates to isolated polynucleotide and polypeptide sequences derived from a new chimpanzee adenovirus ChAd157, as well as re combining: polynucleotides, vectors:, adenoviruses, cells and compositions comprising said polynucleotide and polypeptide sequences.
BACKGROUND OF THE INVENTION
The adenovirus has been widely used in gene transfer applications in terms of its ability to allow efficient gene transfer into a variety of tissues, targets of high transgene capacity. Conventionally, El adenovirus: are deleted and replaced transgenic cassette consisting of the chosen promoter, a cDNA sequence of the gene of interest and a poly A signal, resulting in a recombinant virus deficient p ο ύ rsar ep: 1 icon.
The recombinant / adenoviruses are. useful in gene therapy and as vaccines. The viral vectors based on chimpanzee adenoviruses represent an alternative to the use of adenoviral vectors of human origin development of genetic vaccines. Chimpanzee isolates are closely adenoviruses isolated from humans, as evidenced by their efficient propagation of cells of human origin. However, since for. r · adenovirus related to is put into
BE2017 / 5910 human and chimpanzee adenoviruses are close relatives, serological cross-reactivity between the two viral species is possible,
II. There is a need for vectors which efficiently deliver molecules to a target and minimize the effect of preexisting immunity to adenoviral serotypes selected from the population. One aspect of preexisting immunity that is observed in humans is humoral immunity, 1.0 which can result in the production and persistence of antibodies which are specific for adenoviral proteins. The humoral response elicited by the adenovirus is primarily directed against the three major structural proteins of the capsid: fiber, penton and hexon.
SUMMARY OF THE INVENTION
The present invention relates to an isolated polynucleotide, in which the polynucleotide codes for a polypeptide selected from the group consisting of:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 1; and (b) a functional derivative of a polypeptide having the. amino acid sequence according to SEQ ID NO: '1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1.
1 / the invention also relates to a recombinant polynucleotide comprising a polynucleotide selected from the group consisting of:
BE2017 / 5910 having the a polynucleotide which codes for an amino acid sequence polypeptide according to SEQ ID NO: 1;
and derivative po1yhuclé ot ide (b) un une f one antin 'f one which codes for a
tlouncl d '' a polypeptide having 1 has sequence d ^! acids és according to SEQ ID NO: 1, in which 1 e. derivative tional a a sequence of ’Acids amines who present identity at least 99, 8% on all his length
1.
NO with
The invention also relates to a recombinant vector comprising a polynucleotide selected from the group consisting of:
a polynucleotide which codes for a polypeptide having the
ID NO: 1;
and a polynucleotide which codes for a functional acid derivative of a. polypeptide
amines according to SEQ ID NO: 1, in works.]. to one sequence of 'acids an identity of at minus 99, 8:% on with the sequence c you acid friend . born of
whole amino
SEO ID which the
The invention also relates to a derivative which has its length
NO: 1.
a recombinant adenovirus comprising at least one polynucleotide or a polypeptide (a) one selected from the group consisting of: polynucleotide which codes for a polypepti having the (b) amino acid sequence according to SEQ a polynucleotide which codes for
ID NO: 1;
a functional derivative of an amino polypeptide according to SEQ ID NO:
having the sequence of., in which the functional derivative acid has an amino acid sequence which has
BE2017 / 5910
an identity of at minus 99.8% all over her length with the sequence d 'amino acids from SEQ ID NO : 1; (c) a polyj septid having the sequence of acids amines according to SEQ I D KO: 1; and (d) a derivative 3 fonet i o nne1 of a polypeptide having
the amino acid sequence according to SEQ ID NQ: 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of 10 SEQ ID NO: 1.
The present invention also relates to a composition comprising at least one of:
(a) an isolated polynucleotide which codes for a polypeptide having the sequence of ¹ amino acids according to SEQ
ID NO: 1;
(b) an isolated polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO *. 1, in which the
functional derivative has a sequence of acids amines who present an identity of at less 99.8% if ar all its length1 " with the sequence of- acids amines ck ï SEQ ID NO .1. /(VS) a polypeptide isolated having 1 has sequence acids amines according to SEQ ID NO: 1 r(d) a function derivative nel isolated from a polypeptide having the acid sequence s imined according to SEQ ID NO: 1,
in which the functional derivative has a sequence
amino acids who presents nne identity of at least 99.8% on all its length with the acid sequence amines of SEQ ID NO: 1;
BE2017 / 5910 (e) a vector comprising a polynucleotide such
as described in (a) or. (b). here sssus; and(f) an adenovirus re> combining including apolynucleotide as described in (a) or (b) below ; sus, 5 and a pharmaceutical excipient sment a-ccep: table. The present invention concerned also a
cell comprising at least one of:
(a) a polypeptide polynucleot having the seq: wrinkledLience isolates whot of ai acids code for one.ni n e s s Ion S EQ 1: 0: ID NO t 1, (b) a po1ynu c l eot ide isolated who code for one
functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO * 1, wherein the functional derivative has an acid sequence. amino acids which have an identity of -d ^r at least 99.8% over its entire length with the amino acid sequence of SEQ TD NO;
(c) a vector comprising a polynucleotide as described in (a) or (b) above, and (d) a recombinant adenovirus comprising a polynucleotide as described in (a) or (b) above.
1 / invention also relates to a. isolated adenoviral polypeptide, selected from the group consisting of:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 1; and.
(b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which re derivative: functional has an amino acid sequence which has an identity of at least 99.8% sure
BE2017 / 5910 full length with the amino acid sequence of SEQ ID NO: 1.
DESCRIPTION OF THE FIGURES
Figures 1A-.1D - Alignment of fiber protein sequences of the simian adenoviruses indicated.
ChAdl57 (SEQ ID NO: 1)
ChAd3 (SEQ ID NO: 27)
PanAdB (SEQ ID NO : 28)ChAdl7 (SEQ, ID NO : 29)10 ChAdl9 (SEQ ID NO : Bö)ChAd24 (SEQ ID NO : 31)ChAdl55 (SE < 2 ID N ( 3: 7)ChAdl1 (SEQ I D NO : 32)ChAdEO (SEQ ID NO : 33)15 ChAd31 (SEQ ID NO : 34)PauAdl (SEQ ID NO : 35)PanAd2 (SEQ ID NO : 36)Figure 2 Re pre sen ta t i on s unemployai1 qu e from 1 nsi vette BAC of s · Qus-gn supe C20 Figure 3 Rep thematic presentation from 1 plas shuttle midday- only subgroup CFigure 4 ... Repressed sent at ion. schematic of vecteù pChAdl.57 ΔΕ1 / Tet < 0 hCMV GAGFigure 5 Schematic representation from 1 25 PARS shuttle Sue ciesC / AdSorf6-2
Figure 6 ~ Schematic representation of the plasmid carrying the ChAdl57 RG
Figure 7 - Expression of transgenes by
ChAdl57 / GAG, ChAdl9 / GAG and ChAdl55 / GAG
Figure 8 - Western analysis of lysates of Hela cells infected with ChAdl55 / RG and ChAdl57 / RG
B E2017 / 5910
Figure 9 - Immunological power of ChAdl57 / GAG, ChAdl55 / GAG and ChAdl9 GAG in BALB / c mice
Figure 10 - Immunological power of ChAdl57 / RG and ChAdlS.5 / RG 'in BALB / c mice
Figure 11 ~ Neutralization titers following the pre-immunization of mice with different Ch Ad vectors
Figure 12 - ELlSpot d / IFNy following vaccination of mice with ChAdl57 / GAG after different regimes of] p pre-immunization
DESCRIPTION OF THE SEQUENCES
SEQ ID NO : 1 - Sequence polypeptide of the fiber ChAdl57 SEQ ID NO: 2 - Pol sequence . yn uc1éot i dique coding. for the f '' of ChAdl.57 SEQ ID NO; 3 - Pol sequence . yp ept id i que du penton from ChAd15 > 7 SEQ ID NO: 4 - Pol sequence . yn uido t idique coding
of lice the penton of ChAdl57
SEQ ID NO: 5 ~ Polypeptide sequence of the hexAd Ch57
SEQ ID NO: 6 - Polynucleotide sequence coding for 1 / hex of ChAdl57
SEQ ID NO: 7 - Polypeptide sequence of the ÇhAdlSS fiber
SEQ: ID NO: 8 - Polynucleotide sequence coding for the ChAdlSS fiber
SEQ ID NO: 9 - Polypeptide sequence of the ChAd155 penton
SEQ ID NO: 10 - Polynucleotide sequence coding for the ChAdlSS penton
BE2017 / 5910
SEQ ID NO: 11 - Polypeptide sequence of
The hex of ChAdi 55
SEQ ID NO: 12 - Polynucleotide sequence coding for the ChAdlSS hexon
SEQ ID NO: 13 - Polynucleotide sequence coding for wild-type ChAdlSh
SEQ ID NO: 1'4 - Polynucleotide sequence of the BAC shuttle of subgroup C (# 1365)
SEQ ID NO: 15 - Stock Footage p o 1 yn u key o t i d i qu e of 10 pChAdlSV. ÛE1 TetO. hCMV RpsLKana # 155 1SEQH-n VT Μ ID NO: 16 - Pol sequence ynue1é o tldi qu e de Gag tï LJ- </ .LUSEQ ID NO: 17 - Stock Footage polynucleotide of pChAdlST ΔΕΙ / TetO hCMV GAG 15 SEQ ID NO: 18 - Stock Footage p o 1 y nu c 1 éo t i d i que of The primer 1 Ad5orf6 SEQ ID NO: 19 - Stock Footage p o 1 y nue 1 é 011 d i q ue- of the primer 2 Ad5orf6 SEQ ID NO: 20 - Stock Footage idyllic polynucleot of 20 primer 1 Fiber-polyA E4 SEQ ID NO: 21 - Stock Footage poiy nu c1éot idi que _: of .1 primer 2 Fiber-polyA E4 SEQ ID NO: 22 - Stock Footage p o 1 y n u c 1 identical. of ChAd'157 ~ ÛElE4_Ad5E4orf6 / TetO hCMV Rp s L-Kana # 159425 SEQ ID NO: 23 - polynucleotide sequence of the qlycopro tine of rabies SEQ I'D NO: 24 - Stock Footage ; jo1y nucleo t idique of pChAd.157 Δ E1E 4 Ad5E4Or f 6 / Tet0 hCMV 'RG #} 75'SEQ ID NO: 25 - Stock Footage poN ynucléoridigue of 30 1 ^r primed CMFfor
BE2017 / 5910
SEQ ID NO: 26 - Polynuclcolidigue sequence. of
The primer CMErev
SEQ ID NO: 27 - Stock Footage acids eliminated for the protein fiber of ChAd3 5 SEQ ID NO ; 28 ~ Sequence of acids amines for 1 3 protein fiber of Pan.Ad3 DRY) ID NO • 29 - Sequence acids amines for the protein fiber of ChAdl SEQ ID NO • 30 - Sequence of acids amines for the 10 protein fiber of ChAdl9 SEQ ID NO * · 31 - sequence acids amines fear the protective fiber of ChAd24 SEQ ID NO : 32 - Stock Footage acids amines: for the protein fiber of ChAdl1 15 SEQ ID NO ; 33 - Sequence acids amines for .1.3 protein fiber of ChAd20 SEQ ID NO - 34 ~ Sequence acids amines for the protein fiber of ChAd3I SEQ ID NO : 35 - Stock Footage acids amines for the 20 protein fiber of PanAdl SEQ ID NO • 36 - Sequence acids amines for the protein fiber of PanAd2 SEQ NC ID >: 37 - Polynu sequence rucleotide of
hCMV (tetO)
SEQ ID NO: 38 - Polynucleotide sequence of shuttle plasmid # 1376 of subgroup C
SEQ ID NO: 39 - Polynucleotide sequence of BGH polyA
SEQ ID NO: 4: 0 - Polynucleotide sequence of pARS SpeciesC Ad5orf6-2
BE2017 / 5910
SEQ. ID NO: 41 - Polynucleotide sequence of the CMWÄM-TAMRA probe
SEQ ID NO: 42 ~ Polynucleotide sequence coding for the hCMV promoter
DETAILED DESCRIPTION OF THE INVENTION
The vectors, compositions and methods of the present invention may exhibit one or more of the following improved features over the prior art, including but not limited to higher productivity, improved immunogenicity, increased expression of transgenes or a distinct profile of serological cross-reactivity.
The vectors, compositions and methods of the present invention may have a combination of properties, such as productivity, immunogenicity, expression of transgenes and / or serological cross-reactivity, which means that they constitute a valuable alternative to known approaches.
.Adenovirus
The adenoviruses have a characteristic morphology including the base of the penton together with an i c o s a d r i g hex (II), button (IV),
3Ö with a capsid major proteins, (III) and a fiber a number of other minor proteins, VT, VIII, of the virus is a DNA double intimately associated with a small peptide pX another protein, V, is
IX, Ilia and iVaî .. The linear strand genome. Viral DNA is very basic protein VII (formerly known as mu).
bundled with this DNA-protein complex and provides a and
A
BE2017 / 5910
structural link with the c · apsidf s via the. p r o t e i ne VI. The virus contains also a protease coded by the virus, which is necessary to treat some of for r. e i ne s s t r u c thickets and prod: □ ire the v infectious irus mature. I.e genome adenoV irus is .b the n characterized. L'org an isa. we are overall of genome a adenoviral is generally preserved mt ca dre s of .reading open s peci f i that s posit aunt s of man: 1st s im. It aire, e, g. 1 location snt managers your El .A, E1B, E 2 A, E2B, El, E4
.LI, L2, L3, L4 and 15 of each virus. Each end of the adenoviral genome includes a sequence known as a terminal inverted repeat (ITR), which is necessary for viral replication. The virus
15: includes equal lie a pro teas < s coded pa the virus, whichis necessary i for trait er i me part of. proteinstructural required p our produce the virionsinfectious. L. at. structure of genome a tdenoviral isdescribed in se basing on .1 .'order in the what genes 20 viral are expressed following go nt the trans duetion ofhost cell More specifically, we refers toto the genes vi. waters like to the pr genes harsh (E) orlate (L) Ion that the t r.ans.i oription occurs beforeor after the start of the r crease cation of DNA. In the 25 early phase trans duct: tone, the E1A, ETE genes,Ξ2Α, E2B, E3 < a st e4 .déno viruses are expressed forprepare the o host cell p.yes respite cation line.During the late phase of i 'inf ection, I ' expression oflate genes L1-L5., Which cod ent for components 30 structural of s particles viri have it is Activated.
B E2017 / 5910
Adenoviruses are species specific and different serotypes, ie types of viruses which are not cross-neutralized by antibodies, have been isolated from a variety of mammalian species. For example, more than 50 serotypes have been isolated from humans which are divided into 6 sound-groups (AF; B is sub-divided into B1 and B2) according to sequence and homology. of their ability to clump the blood cells. red (Tat sis and Ertl pg Molecular Therapy (.2004) 10: 616, 629-620). Many adenoviruses have been isolated from non-human simians such as chimpanzees, bonobos, rhesus macaques and gorillas, and they are classified into the same human groups based on phylogenetic relationships based on hexon or fiber sequences (Colloea et al. (2012) Science Translational Medicine 4:. 1-9; Roy et al. (2004) Virology 324:
361-372; Roy et al. (2010) Journal of Gene Medicine 13: .17-25).
2Q WO2005071093 describes chimpanzee adenovitus, including ChAd19. WO2016198621 (PCT / EP2016 / 063329) describes the chimpanzee adenovirus ChAdlSS, and is incorporated into the present document by way of reference for the purposes of defining the vectors derived from ChAdl55.
Adenoviral capsid proteins including ..... fiber protein and polynucleotides encoding these proteins
As pointed out above, the adenoviral capsid comprises three major proteins, hexon, penton 30 and fiber. The hexon represents the majority of the structural components of the capsid, which is
BE2017 / 5910 consisting of 240 trimeric hexon capsomers and 12 penton bases. The hex has three preserved double barrels, while the top has three towers, each round containing a loop of each subunit 5 which forms most of the capsid. The base of the hexon is highly conserved between the adenoviral serotypes, while the surface loops are variable (Tatsis and Ert.l Molecular Therapy (2004} 1.0: 616,629-629}.
Penton is another adenoviral 10. capsid protein that forms a pentameric base to which the fiber attaches. The trimeric fiber protein protrudes from the base: from the penton at each of the 12 vertices of the capsid and is a rod-to-button structure. A remarkable difference in the surface area of adenoviral capsids compared to that of most other icosahedral viruses is the presence of the long, thin fiber protein. The main role of the fiber protein is the attachment of the viral capsid to the surface of the cell via its interaction with a cellular receptor.
The fiber proteins of many adenovirus serotypes share a common architecture: an N-terminal tail, a central stem made up of repeated sequences, and. a globular button C25 terminal domain (or “head”). The domain: the central rod is made up of a variable number of beta repetitions.
form an elongated structure of three strands in an N-terminal tail spiral to the globular button structure, which is responsible
BE2017 / 5910 nature, globular of the button domain of the adenovirus has large receptor binding surfaces laterally and at the top. IV effect of this architecture · is to project the receptor binding site away from the capsid of the virus, thus liberating the virus from steric constraints presented by the relatively flat capsid surface.
Although the fibers of many adenovirus serotypes have the same, overall architecture, they: 10 have variable amino acid sequences which influence their function and structure. For example, many exposed regions on the surface of the fiber button have an easily adaptable receptor binding site. The globular shape of the fiber button allows receptors to bind at the sides of the button or on top of the fiber button. These binding sites are typically found on the loops exposed to the surface connecting the beta strands which are poorly conserved among the human adenovirus. The side chains exposed on these loops give the button a variety of surface characteristics while preserving the tertiary and quaternary structure. For example, the electrostatic potential and distributions of 25. charges at the button surfaces may vary due to the wide range of isoelectric points in the fiber button sequences, from a pi of about 9 for Ad8, Ad 19, and Ad 37 at about 5 for adenoviruses of subgroup B. As a structurally complex viral ligand, the fiber protein allows the presentation of a variety of surfaces
BE2017 / 5910
of link (tip " a) in a number dorienta tions and di st a n c e s (t i g e} since The viral capsid. One of variety) ions the most hollow ntes between this r t a i n s s r ό t y p > es est the length of the fiber. Of and udes put ë »N hollowed out this year that the length of the rod of fiber ir if he read f ort emen t int reaction of bo uton and virus with his target receptors s. Furthermore, the ability to to bend proteins f ihres can
also vary between serotypes. Although the pg beta repeats in the. rod form a highly stable and regular structure, studies by electron microscopy (EM) have highlighted distinct hinges in the fiber. Analysis of the protein sequence of several fibers of adenoviral serotypes shows an interruption in the repeat sequences of the rod at the level of the third beta repeat from the N-terminal tail, which is strongly correlated with one hinges in the rod, as- this is observed by electron pg microscopy. The hinges in the fiber allow the button to adopt a variety of orientations with respect to the viral capsid, which can prevent steric hindrance upon receptor engagement requiring the correct presentation of the receptor binding site on the button. For example, the rigid fibers of adenoviruses of the subgroup D thus require a flexible receptor or a pre-positioned for the fixation of the virus, since they are unable to fold themselves. (Nicklin et al. 3Q Molecular Therapy 2005 12: 384-393)
B E2017 / 5910
The Identiti ^r ac t on specific cell of different serotypes of Ad and knowledge of how they contribute to 's permitted by the use of pseudotype technology by the fibers. Although adenoviruses in certain subgroups use their primary, clsir alternative primary receptors _r leading to a significantly different tropism in vitro and in vivo.
The net in their primary structures and such as the stiffness of the rod the length of the fiber rod, and the absence of a binding site
CAR and / or the putative reason for
H S P G, together with the differences in net load inside the fiber button. Pseudotyping particles of Ad 5 with another rod and another the possibility of suppressing * important binding in addition, can allow a more efficient delivery of transgenes (and potentially more in relation to cell types to that obtained with Ad neutralization of Ad particles pseudotyped by the fibers can also be reduced if the fibers come from adenoviruses having a lower seroprevalence in humans or experimental models, a situation which favors the successful administration of the vector (Nicklin et al. Molecular Therapy (2005 ) 12: 384-393).
B E2017 / 5910 full length fiber, as well as isolated fiber button regions, but not hexon or penton alone, are capable of inducing the maturation of dendritic cells and are associated with the induction of powerful response of CD8 + T lymphocytes (Molinier-Frenkel et al. J. Biol. Chem. (2-0Ό3) 278:
37175-37182). Overall, adenoviral fiber plays an important role at least in binding to receptors and the immunogenicity of adenoviral vectors.
The alignment proposed in FIG. 1 illustrates the differences between the fiber proteins of the group C simian adenoviruses. A striking element is that the fiber sequences of these adenoviruses can be broadly grouped into sequences having a short fiber, for example ChAd157, or a long fiber, for example ChAdl.55. This: length differential is due to a deletion of 36 amino acids at position 321 approximately in the short fiber compared to the long fiber. In addition, there are a number of amino acid substitutions which differ between the short versus long fiber subgroup, but which remain consistent within each subgroup. Although the exact function of these differences has not yet been elucidated, given the function and immunogenicity of the fiber, these differences are likely to be relevant. It has been pointed out that one of the determinants of viral tropism is the length: of the stem of the fiber. It has been highlighted that. AdS vector with shorter stem had lower CAR receptor binding efficiency and lower infectivity (Ambriovic18
BE2017 / 5910
Ristov A. et al
Virology.
(2003) 312 (2}
The postulate was issued short leading to
77 (13}: 72
In one of the increased fiber stiffness deficiencies plus one (Wu, appearance, less effective fixation to the
Virol. (2003) ^f the invention relates to an isolated chimpanzee adenovirus fiber isolated polynucleotides encoding the polypeptide fiber Chimp 1'adénovirus
C.hAdl57.
Or expects that the fiber protein contributes to a low seroprevalence and that it can, thus, be used independently of the polypeptides of the hexon and the penton of ChAdl57 or in combination (with one or the other or both of hexon and penton) to suppress the affinity of an adenovirus towards preexisting neutralizing antibodies, eg to make a recombinant adenovirus with a
2g reduced seroprevalence. Such a recombinant adenovirus can be a chimeric adenovirus with capsid proteins of different serotypes with at least one fiber protein from ChAd157,
The polypeptide sequence fiber of ChAdl57 25 is. given in SEQ ID NO: 1. The se q ue n ce p o 1 yp ep tri d i qu e penton of ChAdl57 East given in SEQ ID NO: 3. The se que n c e po1yp eptldi qu e hexon of ChAdl57 East given in SEQ ID NO: 5.
B E2017 / 5910
Recombinant polypeptides, adenoviruses, compositions or cells comprising renal polypeptide sequences of the ChAdl57 fiber or a functional derivative thereof
Suitably, the isolated polypeptide,
The recombinant adenovirus, the composition or the cell of the invention comprise a polypeptide having the amino acid sequence according to SEQ ID NO: 1.
The polypeptide, the recombinant adenovirus, the composition or the cell of the invention may comprise a polypeptide which is a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the derivative functional has an amino acid sequence which has at least 99.8% identity over its entire length with the amino acid sequence of SEQ ID NO: 1.
Alternatively, the functional derivative has no more than one, addition, deletion or substitution with respect to SEQ ID NO: 1, for example a substitution with respect to SEQ ID NO: 1.
2p. Suitably, the polypeptide, the recombinant adenovirus, the composition or the cell according to the invention further comprises:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3; or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which the functional derivative has an amino acid sequence which has an identity of at least 60% over its whole length with the amino acid sequence of 30 SEQ ID NO: 3, and / or
BE2017 / 5910 (a) a polypeptide having the amino acid sequence according to SEQ ID NO: 5; or (b) cm functional derivative of a polypeptide having
the amino acid sequence according to SEQ: ID NO : 5, in whichone. functional derivative has a sequence ; of acids amines which has an identity of at least 60% on its entire length with the: acid sequence amines from
SEQ ID NO: 5.
Suitably, the functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3 has an amino acid sequence which has an identity of at least 70% over its entire length with the sequence d amino acids of SEQ ID NO: 3, such as at least 80%, in particular at least 90%, by 1: 5 for example at least 95% or at least 98%.
Suitably, the functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5 has an amino acid sequence which has an identity of at least 70% over its entire length with the amino acid sequence of SEQ I'D NO: 5, such as at least 80%, in particular at least 90%, for example at least 95% or at least 98%.
In particular, the polypeptide, the recombinant adenovirus, the composition or the cell according to the invention further comprises:
(at)amines themselves a: lon polypeptideSEQ ID NO: 3 having the; and or sequence acids(-0) a polypeptide having the sequence of acids friend Ines according to. SEQ ID NO: 5
BE2017 / 5910
Isolated po1riuc1éotides, _t vectors, adenovir recombinant bones, compost. tlons or cells comprising polynucleotides encoding the fiber for ChAdl57 ..... or a derivative i ve 1 of this --pi
Suitably, the isolated polynucleotide, the vector, the recombinant adenovirus ₍ the composition or the cell of the invention comprises a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1. De suitably, the polynucleotide has a sequence according to SEQ ID NO 2.
When the isolated polynucleotide, the vector, the recombinant adenovirus, the composition or the cell of the invention comprises a polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1 , in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the sequence: of amino acids of SEQ ID NO: 1, the polynucleotide a, of suitably., a sequence according to SEQ ID NO: 2 in which a codon has been added, deleted or modified to code for a different amino acid.
Suitably, the polynucleotide, the vector, the recombinant adenovirus, the composition or the. cell 25 of the invention further comprises a polynucleotide encoding:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3; or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which the functional derivative has an acid sequence
BE2017 / 5910 amino acids which have an identity of at least 60% over its entire length with the amino acid sequence of SEQ ID NO: 3, and / or (a) a polypeptide having the amino acid sequence according to SEQ ID NO: 5 / or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5, in which the functional derivative has an acid sequence | g, amino acids which have an identity of at least 60% over its entire length with the amino acid sequence of SEQ ID NO: 5.
Suitably, the functional derivative of a polypeptide having the amino acid sequence according to SEQ 3 5 ID NO: 3 has an amino acid sequence which has an identity, of at least 70% over its entire length with the amino acid sequence of SEQ ID NO: 3, such as at least 80%, in particular at least 90%, for example at least 95% or at least 98%.
Suitably, a functional derivative of a polypeptide having the amino acid sequence according to SEQ is an amino acid sequence which has an identity of at least 70% over its entire length with the amino acid sequence d.e
SEQ ID NO:
5, like
9 at least 80%, in particular at least%, for example at least 95% or at least 98%.
In particular, polynucleotide, the vector,
The recombinant adenovirus, the composition or cell of the invention comprises
3Q coding for
BE2017 / 5910 (a) a.
polyp p t i of amino acids according to; and / or (b) an ide polypeptide having the acid sequence the vector,
The recombinant adenovirus, the composition or the
The invention may also comprise * (a) a polynucleotide according to SEQ ID NO (b) a polynucleotide according to SEQ I'D NO and / or
Skeletons of ChAdl57
The invention relates to isolated polynucleotide sequences d ¹ chimpanzee adenovirus ChAdlSl, including those of unmodified wild type ChAdl57 and .squelette constructions modified ChÂdl57t These modified backbone constructs include those proposed in the examples, e.g. pChAdl57AEl TetO hCMV RpsLKana # 1551 {SEQ ID NO: 15) and ChAdl57
ΔΕ1Ε4 Ad5E4orf6 / TetO hCMV RpsL ~ Kana # 1594 (SEQ ID NO:
2.2). The backbones of ChAd157 can be used in the construction of recombinant adenoviruses competent for replication or incompetent for replication, for example for the delivery of genes.
1 / annotation of the sequence of pChAdl.57 ΔΕΙ / TetO hCMV GAG (SEQ ID NO: 17) is given below.
BE2017 / 5910
Atii-iohiiti οπ5 ChAcÎ157DÉl JTetÓhCMV GAG
T.X 3187. . 3651
IVa2 'mplvrm‘lit (Πΐιι. .5045, 5325. .5337)
Pol romptement (481 6..> V-i7, 13762 .. 13770)
VA RNA1 10238. .19 V ·) pTP ”.ei> tPiurnt (Rim .. 111>, 1 ^ '· 2 .BUN
48K lu652. .11914 plundered 11938. .13714
I.ÎÏ 13807. .1 5588 pVII 15603..16199
V 16279, .173013 pX) 7415..17 ^ 0 pvi 17750..13503
Hexon 18623..21499 /15/).,22158
DSP Complement (22274. .23926)
K 2397 6 .. 2 6447 '
22K 26104 ... 2673 9
33K J jxr> (. 611.4.. '6473,1> U Z «.. 270il}
K2e promctei Complement 127027..27274) pV.ni 27136. .27819
Ê3 12K 27820..28137
F.3 'VU-alpb ij 0 .61.30., 2 335
Γ> qph'K îh. .. '1 / e
E.3A 11K 30776. .31072
1: 5
E3 RID alpha 31 034 .. 313.56
E 3 Rï D bat a 3155 ·) .3) 757
E3 15K 31750. .32136
U exon Complement (32167..32331) fiber 32342..33973
E4 OP.F6 / 7
E4 ORF6
E4 ORF4 '. uple ".„ t 1141 '! .. Miss ι, ΛιΡ. . 5 ml)
Complement: (34457. .35341)
Complement (35241.. .35606)
E4 OR F.3
E4 ORE2
E4 ORB’l
Complement {35i · / . . 35969) i ’> • mvlcment (. 3oJbc)
Complement. (36411 <. 36797)
In one embodiment, the fragments of the sequences of SEQ ID NO: 15, 22 and their complementary strands, their cDNA and their complementary RNA are proposed. Suitably, the fragments are at least 15 nucleotides in length, more suitably 3-0 nucleotides in length, more suitably 60 nucleotides in length, more suitably with a length of 120 nucleotides, more preferably 240, more preferably with a length of 480 nucleotides and. include functional fragments, in other
BE2017 / 5910 terms., Fragments which are of biological interest. For example, a functional fragment may express a desired adenoviral product or may be useful in the production of recombinant viral vectors. Such fragments include the gene sequences proposed in the list below. In certain embodiments, the sequences isolated from SEQ ID NO: 1.5, 22 and their complementary strands, their cDNA and their complementary RNA are proposed.
The gene products of the ChAd157 adenovirus, for example proteins, enzymes, and fragments thereof, which are encoded by adenoviral nucleic acids, and the aforementioned fragments thereof, described in this document are proposed. Such telprotein.s include those encoded by the open reading frames identified above and the proteins encoded by the polynucleotides proposed in the Sequence Listing.
Other ChAdl57 polynucleotides and polypeptides
In some embodiments, the polynucleotide of the invention comprises a polynucleotide encoding a fiber polypeptide; a hexon polypeptide and a gu fiber polypeptide; a pent on- polypeptide and a fiber polypeptide; or a hexon polypeptide, a penton polypeptide and a fiber polypeptide of the invention; and may further comprise additional adenoviral polynucleotides, suitably 3Q polynucleotides of ChAd157. So, suitably,
BE2017 / 5910 the polynucleotide according to the invention comprises one or more of the following:
(a) an adenoviral 5 'terminal inverted repeat (ITR);
5 (b) an El region .A adenoviral, or a fragile havethis! selected among the regions El A 21 3 GOLDE1AJ243R 7 (VS) a region E1B or IX adenoviral, or onefragment of it. i. selected in the group) 10 constituted the regions E1B_19K, E1B__55K and IX;
(d) an E2B adenoviral region; or a fragment thereof selected from the group consisting of the E2B pTP, E2B_polymerase and E2B IVa2 regions;
(e) an L1 adenoviral region, or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of the proteins L1_13.6K, L1__52K and L1 pilla;
(f) an L2 adenoviral region or an L2 region comprising a polynucleotide encoding the penton protein of the invention, or. a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of L2_pe-nton protein, L2__pVII protein, L2_y protein and L2 pX protein;
(g) an L.3 adenoviral region or an L3 region comprising a polynucleotide encoding the hexon protein of the invention, or a fragment thereof, said fragment. coding for an adenoviral protein selected from the group consisting of the protein L3 pVI, the protein L3 hexon and the protein L 3_prot e a s e;
BE2017 / 5910 (h) an adenoviral E2A region;
(i) an adenoviral L4 region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of L4_100k protein, L4_33K protein, L4_22K protein and L4_VIII protein;
(j) an E3 adenoviral region, or a fragment thereof selected from the group consisting of ORF1 of E3, ORF2 of E3, ORF3 of E3, ORF4 of E3, ORF5 of E3, ORF6 of E3 , E3 ORF7, E3 ORF8, and E3 ORF9;
(k) an adenoviral L5 region or an L5 region comprising a polynucleotide encoding the L5_fiber fiber polypeptide of the invention;
(l) an adenoviral E4 region (for example of Ad5), or a fragment thereof selected from the group consisting of ORF7 of E4, ORF6 of E4, ORF4 of E4, ORF3 of E4, ORF2 d 'E4, and ORF1 of E4; in particular of ORF6 of said region E4;
(m) an adenoviral 3'-ITR region; and / or (n) a region of adenoviral RNA VAI or VAII, preferably a region of adenoviral RNA VAI or VAII of an adenovirus other than ChAd157, more preferably of Ad5.
Definitions
Suitably, the polynucleotides or polypeptides of the invention are isolated. An "isolated" polynucleotide is a polynucleotide that is extracted from its original environment. For example, a naturally occurring polynucleotide is isolated if it is separated from all or part of the co-existing materials
BE2017 / 5910 in the natural system. A polynucleotide is considered to be isolated if, for example, it is cloned into a vector which is not part of its natural environment or if it is included in a cDNA.
Suitably, the polynucleotides of the invention are recombinant. Recombinant means that the polynucleotide is the product of at least one of the steps of cloning, restriction or ligation, or other procedures that result in a polynucleotide that is distinct from a polynucleotide that occurs in nature. A recombinant adenovirus is an adenovirus comprising a recombinant polynucleotide. A recombinant vector is a vector comprising a recombinant polynucleotide. A "recombinant virus" includes the offspring of the original recombinant virus. A "recombinant vector" includes replicates of the original recombinant vector. A "recombinant polynucleotide" includes replicates of the original recombinant polynucleotide.
Suitably, the polypeptide sequence of the present invention contains at least one modification from a native sequence. Suitably, the polynucleotide sequences of the present invention contain at least one modification with respect to a native sequence. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species (and often from a different genus, subfamily or family) is a heterologous polynucleotide. A promoter extracted from its native coding sequence and functionally linked to a
BE2017 / 5910 coding sequence with which it is not found to be naturally linked is a heterologous promoter. A specific recombination site that has been cloned into a genome of a virus or viral vector, in which the genome of the virus does not naturally contain it, is a heterologous recombination site. A heterologous nucleic acid sequence also includes a sequence naturally found in an adenoviral genome, but located at a non-native position inside the adenoviral vector.
Typically, "heterologous" means derived from a genotypically distinct entity from that of the rest of the entity with which the comparison is made. A heterologous nucleic acid sequence refers to a nucleic acid sequence which is not isolated from, derived from, or based on a natural nucleic acid sequence of the adenoviral vector. A heterologous protein sequence refers to any protein sequence that is not isolated from, derived from, or based on a natural protein sequence of the adenoviral vector. "Natural" means a sequence encountered in nature and not synthetically prepared or modified. A sequence is "derived" from a source when it is isolated from a source but modified (for example, by deletion, substitution (mutation), insertion, or other modification) in a manner adapted so as not to disturb the function source gene normal.
A "functional derivative" of a polypeptide suitably refers to a modified version of a polypeptide, for example, in which one or more amino acids of the polypeptide can be deleted,
BE2017 / 5910 inserted, modified and / or substituted. An unmodified adenoviral capsid protein derivative is considered functional if, for example:
an adenovirus comprising the derivative of a capsid protein inside its capsid retains substantially the same seroprevalence or a lower seroprevalence compared to an adenovirus comprising the unmodified capsid protein, and / or (b) an adenovirus comprising the derived from a capsid protein to
The interior of its capsid retains substantially the same infectivity of the host cell or a higher infectivity of the host cell compared to an adenovirus comprising the unmodified capsid protein, and / or (c) an adenovirus comprising the derivative of a capsid protein inside its capsid retains substantially the same or higher immunogenicity compared to an adenovirus comprising the unmodified capsid protein, and / or (d) an adenovirus comprising the derivative of a capsid protein to the interior of its capsid retains substantially the same level, or a higher level, of transgenic productivity compared to an adenovirus comprising the unmodified capsid protein.
Properties (a) to (d) above can suitably be measured using the methods described in the Examples section below.
Suitably, the recombinant polypeptide, vector or adenovirus has a low seroprevalence in the human population. "Low seroprevalence"
BE2017 / 5910 may mean having a reduced level of preexisting neutralizing antibody compared to human adenovirus 5 (Ad5). Similarly or alternatively, "low
seroprevalence " can mean a seroprevalence lower at about 20 Oθ r a seroprevalence lower at about 15 oθ r a seroprevalence lower at about 10 oθ r a seroprevalence lower about 5% , a seropreval lower enclosure
at approximately 4%, seroprevalence less than approximately 3%, seroprevalence less than approximately 2%, seroprevalence less than approximately 1%, or no detectable seroprevalence. Seroprevalence can be measured as the percentage of individuals with a clinically relevant neutralization titer (defined as a neutralization titer of 50%> 200) using the methods described in Aste-Amézaga et al., Hum. Gene Ther. (2004) 15 (3): 293-304.
The terms polypeptide, peptide and protein are used interchangeably in this document.
The term "simian" is typically understood to include non-human primates, for example Old World monkeys, New World monkeys, great apes and gibbons. Simien can in particular refer to non-human great apes such as chimpanzees (Pan troglodyte), bonobos (Pan paniscus) and gorillas (genus Gorilla). Simians other than great apes may include rhesus macaques (Macaca mulatta).
BE2017 / 5910
Sequence comparison
For the purpose of comparing two closely related polynucleotide or polypeptide sequences, the "% identity" between a first sequence and a second sequence can be calculated using an alignment program, such as BLAST® (available at next blast.ncbi.nlm.nih.gov, last accessed March 09, 2015) using standard settings. The percent identity is the number of identical residues divided by the number of residues in the reference sequence, multiplied by 100. The percent identity values referred to above and in the claims are calculated percentages by this methodology. An alternative definition of percentage identity is the number of identical residues divided by the number of aligned residues multiplied by 100. Alternative methods include the use of a gap method in which holes in the alignment, for example deletions in a sequence with respect to the other sequence, are taken into account by a hole score or a cost of holes in the score parameter. For more information, see the BLAST® data sheet available at the following address ftp.ncbi.nlm.nih.gov/pub/factsheets/HowTo_BLASTGuide.pd f, last accessed March 09, 2015.
Sequences which retain the functionality of the polynucleotide or a polypeptide encoded in this way are likely to exhibit greater identity. It is considered that the polypeptide sequences or
BE2017 / 5910 are the sequences if they their total length. "Difference" between an insertion, one of an amino acid residue the second sequence, compared to the
Two polypeptide sequences one, two or more of these differences insertions deletions sequence which is 100% sequence) to polynucleotides, other polynucleotides, 100%
A sequence position substitution reference. contain amines. The second one (identity of result in reduced. By of a length in the second sequence of 88.9 of a length of in the second sequence of 88.2 of a length of 7 in the second sequence of sequences acidic residues the first share an identity and the second identity sequences of 66.7%).
polypeptide sequences a percentage example, if of 9 amino acids, sequence results in%. If the amino acid sequences, sequence result%. If the amino acid sequences, sequence result
57.1%. If the polypeptides are amino and share and second the same as, or identical polypeptides or share an identity of sequences of deletion or a unique to a first can of acids or substitutions in otherwise identical a first sequence of identity of sequence identical sequences are a substitution an identity of identical are two substitutions in an identity of identical are three substitutions in an identity of first and second of a length of 9 identical residues, polypeptide% (the first share one the first and second are of a length of 17 sequences greater than 66 Si polypeptides
BE2017 / 5910 amino acid residues and share 16 identical residues, the first and second polypeptide sequences share an identity (the first and second polypeptide sequences share an identity of 94.1%) second polypeptide sequences of 7 identical amino acid residues, the first polypeptide share a
If are and and the first and of a length share 3 second identity residues (the first and second sequences share an identity of 42.9%).
Alternatively, for the purposes of a first polypeptide sequence, a second polypeptide sequence number of additions, substitutions of polypeptide sequences from reference to comparison, the and / or deletions made to the second sequence first sequence to produce the can be checked. An addition is the addition of a first polypeptide residue (y of either first polypeptide).
amino acid in the sequence of including an addition at the terminal ends of the substitution of a residue of the first different polypeptide. A deletion
A substitution is amino acid in by a residue is the deletion of the amino acid sequence of an amino acid residue of the sequence of the first polypeptide (including a deletion at either end of the first polypeptide ).
For the purposes of comparison of a first reference polynucleotide sequence to a second comparison polynucleotide sequence, the number of additions, substitutions and / or deletions
BE2017 / 5910 made to the first sequence to produce the second sequence can be checked. An addition is the addition of a nucleotide residue in the sequence of the first polynucleotide (including an addition at either end of the first polypeptide). A substitution is the substitution of a nucleotide residue in the sequence of the first polynucleotide with a different nucleotide residue. A deletion is the deletion of a nucleotide residue of the sequence of the first polynucleotide (including a deletion at either end of the first polynucleotide).
Suitably, the substitutions in the sequences of the present invention may be conservative substitutions. A conservative substitution includes the substitution of an amino acid by another amino acid having a chemical property similar to the amino acid which is substituted (see, for example, Stryer et al., Biochemistry, 5th Edition 2002, pages 44-49 ). Preferably, the conservative substitution is a substitution selected from the group consisting of: (i) a substitution of a basic amino acid by another different basic amino acid; (ii) a substitution of an acidic amino acid by another different acidic amino acid; (iii) substitution of an aromatic amino acid with another different aromatic amino acid; (iv) substitution of a non-polar aliphatic amino acid with another different non-polar aliphatic amino acid; and (v) substitution of an uncharged, polar amino acid with another uncharged amino acid,
BE2017 / 5910 different fleece. A basic amino acid is preferably selected from the group consisting of arginine, histidine, and lysine. An acidic amino acid is preferably aspartate or glutamate. An aromatic amino acid is preferably selected from the group consisting of phenylalanine, tyrosine and tryptophan. A non-polar aliphatic amino acid is preferably selected from the group consisting of glycine, alanine, valine, leucine, methionine and isoleucine. An uncharged, polar amino acid is preferably selected from the group consisting of serine, threonine, cysteine, proline, asparagine and glutamine. Unlike a conservative amino acid substitution, a non-conservative amino acid substitution is the exchange of an amino acid by any other amino acid that does not fall into the conservative substitutions (i) to (v) underlined above.
Recombinant vectors and adenoviruses
The ChAd157 sequences of the invention are useful as therapeutic agents and in the construction of a variety of vector systems, recombinant adenoviruses and host cells. Suitably, the term "vector" refers to a nucleic acid which has been substantially modified (for example, a gene or a functional region which has been deleted and / or inactivated) with respect to a wild type sequence and / or incorporates a sequence
BE2017 / 5910 heterologous, in other words, a nucleic acid obtained from a different source (also called an "insert"), and replicating and / or expressing the inserted polynucleotide sequence, when it is introduced into a cell (for example , a host cell). For example, the insert may be all or part of the sequences of ChAd157 described in this document. In addition or alternatively, a ChAd157 vector can be a ChAd157 adenovirus comprising one or more deletions or inactivations of viral genes, for example E1 or other viral gene or functional region described here. Such a ChAd157, which may or may not include a heterologous sequence, is often referred to as a "backbone" and can be used as such or as a starting point for further modifications of the vector.
A vector can be any suitable nucleic acid molecule including naked DNA, a plasmid, a virus, a cosmid, a phage vector such as a lambda vector, an artificial chromosome such as a BAC (artificial bacterial chromosome ), or an episome. Alternatively, a vector may be a transcription and / or expression unit for cell-free in vitro transcription or expression, for example a compatible T7 system. The vectors can be used alone or in combination with other adenoviral sequences or fragments, or in combination with elements from non-adenoviral sequences. The ChAd157 sequences are also useful in antisense delivery vectors, gene therapy vectors, or vaccine vectors. Thus, the invention also relates to vectors
BE2017 / 5910
deliverance of genes, and cells hosts who contain the sequences of ChAdl57. The term adenovirus "Competent for the
replication "refers to an adenovirus that can replicate in a host cell in the absence of any recombinant helper protein included in the cell. Suitably, an adenovirus "competent for replication" comprises the following essential early genes, intact or functional: EIA, E1B, E2A, E2B, E3 and E4. Wild type adenoviruses isolated from a particular animal will be competent for replication in that animal.
The term adenovirus “incompetent for replication” or “deficient for replication” refers to an adenovirus which is incapable of replication because it has been modified to include at least one functional deletion (or “loss of function” mutation), in other words, a deletion or mutation which degrades the function of a gene without completely suppressing it, for example, the introduction of artificial stop codons, the deletion or mutation of active sites or interaction domains, the mutation or deletion of a gene regulatory sequence, etc. or a complete withdrawal of a gene encoding a gene product which is essential for viral replication, for example one or more adenoviral genes selected from
EIA, E1B, E2A, E2B, E3 and E4 (for example ORF1 of E3, ORF2 of E3, ORF3 of E3, ORF4 of E3, ORF5 of E3, ORF6 of E3, ORF7 of E3, ORF8 of E3, ORF9 of E3, ORF7 of E4, ORF6 of 4, ORF4 of 4, ORF3 of E4, ORF2 of 4 and / or ORF1 of 4 ). Of
BE2017 / 5910 particularly suitable, El and optionally
E3 and / or E4 are deleted. In the event of deletion, the aforementioned deleted gene region will not suitably be taken into account in the alignment when determining the percentage of identity relative to another sequence.
The present invention relates to vectors such as recombinant adenoviruses which deliver a protein, suitably a heterologous protein, to cells for therapeutic or vaccine purposes. A vector can comprise any genetic element comprising naked DNA, a phage, a transposon, a cosmid, an episome, a plasmid, or a virus. Such vectors contain DNA from ChAd157 as described herein and a minigene. By "minigene" (or "expression cassette") is meant the combination of a selected heterologous gene (transgene) and the other regulatory elements necessary to direct the translation, transcription and / or expression of the gene product in a host cell.
Typically, an adenoviral vector derived from ChAd157 is designed such that the minigene is found in a nucleic acid molecule which contains other adenoviral sequences in the native region of a chosen adenoviral gene. The minigene can be inserted into an existing gene region to disrupt the function of that region, if desired. Alternatively, the minigene can be inserted into the site of a partially or completely deleted adenoviral gene.
For example, the minigene can be located at the site of a mutation, insertion or deletion, which makes
BE2017 / 5910 non-functional at least one gene from a genomic region selected from the group consisting of EIA, E1B, E2A, E2B, E3 and E4. The term "renders non-functional" means that a sufficient amount of the gene region is suppressed or otherwise disrupted, so that the gene region is no longer able to produce functional gene expression products. If desired, the entire gene region can be removed (and appropriately replaced with the minigene).
For example, for a production vector useful for the generation of a recombinant virus, the vector may contain the minigene and either the 5 'end of the adenoviral genome or the 3' end of the adenoviral genome, or both 5 'end and 3' end of the adenoviral genome. The 5 'end of the adenoviral genome contains the 5' cis elements necessary for packaging and replication; in other words, the 5 'ITR sequences (which function like the origins of replication) and the packaging enhancer domains in
5 'native (which contain the sequences necessary for
Packaging of linear Ad genomes and enhancers for the E1 promoter.
The 3 'end of the adenoviral genome contains the 3' cis elements (including ITRs) necessary for packaging and packaging. Suitably, a recombinant adenovirus contains the 5 'and 3' cis adenoviral elements and the minigene (suitably containing a transgene) is between the 5 'and 3' adenoviral sequences. A vector
BE2017 / 5910 adenoviral based on ChAdl57 may also contain other adenoviral sequences.
Suitably, the vectors based on ChAdl57 contain one or more adenoviral elements derived from the adenoviral genome of ChAdl57 of the invention. In one embodiment, the vectors contain adenoviral ITRs of ChAd157 and other additional sequences of the same adenovirus serotype. In another embodiment, the vectors contain adenoviral sequences which are derived from an adenoviral serotype different from that which provides the ITRs.
As defined herein, a pseudotyped adenovirus refers to an adenovirus in which the capsid proteins of
The adenovirus comes from a different adenovirus from
The adenovirus which supplies the ITRs.
Of more, adenoviruses chimeras or hybrids can be built using the adenovirus described in the present document in use ising techniques known to men of career (see by example, US 7, 291.498). The ITR and all other adenoviral sequence present in the vector of the current invention can be obtained at go of a big number of
sources.
A variety of adenoviral strains are available from the American Type Culture Collection, Manassas, Virginia, or available upon request from a variety of commercial and institutional sources. In addition, the sequences of a large number of strains are available from a variety of databases including, for example, PubMed and
BE2017 / 5910
GenBank. Homologous adenoviral vectors prepared from other chimpanzee or human adenoviruses are described in the published literature (e.g., US 5,240,846). The DNA sequences of a number of types of adenovirus are available from GenBank, including the Ad5 type (GenBank accession number M73370). The adenoviral sequences can be obtained from any known adenovirus serotype, for example serotypes 2, 3, 4, 7, 12 and 40, and further comprising any of the human types currently identified. Similarly, adenoviruses known to infect non-human animals (e.g., monkeys) can also be used in the vector constructs of this invention (e.g., US 6,083,716). Viral sequences, helper viruses (if necessary), and recombinant viral particles, and other vector components and sequences used in the construction of the vectors described in this document are obtained as described below.
Production sequence, vector and adenovirus ¹
The sequences of the invention can be produced by any suitable means, including by recombinant production, by chemical synthesis, or other synthetic means. Suitable production techniques are well known to those skilled in the art. Alternatively, peptides can also be synthesized by well known solid phase peptide synthesis methods.
BE2017 / 5910
Adenoviral plasmids (or other vectors) can be used to produce adenoviral vectors. In one embodiment, the adenoviral vectors are adenoviral particles which are incompetent for replication. In one embodiment, the adenoviral particles are rendered incompetent for replication by deletions in the E1A and / or E1B genes, in particular the E1A and E1B genes. Alternatively, the adenoviruses are rendered incompetent for replication by other means by optionally retaining the E1A and / or E1B genes. Similarly, in some embodiments, the reduction of an immune response to the vector can be achieved by deletions in the E2B genes and / or DNA polymerase. Adenoviral vectors may also contain other mutations in the adenoviral genome, for example, heat-sensitive mutations or deletions in other genes. In other embodiments, it is desirable to keep an E1A and / or E1B region intact in the adenoviral vectors. Such an intact E1 region may be at its native location in the adenoviral genome or be placed in the site of a deletion in the native adenoviral genome (for example, in the E3 region).
In the construction of adenoviral vectors for the delivery of a gene to a mammalian (for example human) cell, it is possible to use in the vectors a whole range of modified adenovirus nucleic acid sequences. For example, all or part of the delayed early adenoviral E3 gene can be
BE2017 / 5910 eliminated from the adenoviral sequence which forms part of the recombinant virus. The function of E3 would not be necessary for the function and production of the recombinant viral particle. Adenoviral vectors can also be constructed with a deletion of at least the ORF6 region of the E4 gene, and more desirably due to the redundancy of the function of this region, of the entire E4 region. Yet another vector of the invention contains a deletion of the delayed early E2A gene. Deletions can also be made in any of the late genes L1 to L5 of the adenovirus genome. Similarly, deletions in the intermediate genes IX and IVa2 may prove useful for certain purposes. Other deletions can be made in the other structural or non-structural adenoviral genes. The deletions discussed above can be used individually, in other words, an adenovirus sequence intended for use according to the present description can contain deletions only in a single region. Alternatively, deletions of whole genes or parts thereof effective to destroy their biological activity can be used in any combination. For example, in an example of a vector, the adenoviral sequence may have deletions of the El genes and of the E4 gene, or of the El genes, E2a and E3, or of the El and E3 genes, or of the El, E2A and E4 genes, with or without E3 deletions, and so on. Any one or more of the E genes may suitably be replaced by an E gene (or one or more reading frames
BE2017 / 5910 open E) genes from a different adenovirus strain. Particularly suitably, the El and E3 genes of ChAdl57 are deleted and the ChAdl57E4 gene is replaced by E4Ad5orf6. As discussed above, these deletions and / or substitutions can be used in combination with other mutations, such as heat-sensitive mutations, to achieve a desired result.
An adenoviral vector lacking one or more essential adenoviral sequences (e.g. EIA, E1B, E2A, E2B, ORF6 of E4, L1, L2, L3, L4 and L5), can be grown in the presence of the missing adenoviral gene products which are necessary for viral infectivity and the spread of an adenoviral particle. These helper functions can be provided by culturing the adenoviral vector in the presence of one or more of the helper constructs (eg, a plasmid or virus) or a packaging host cell.
Complement of incompetent vectors for replication
To generate recombinant adenoviruses having a deletion in any of the genes described above, the function of the deleted gene region, if essential for replication and infectivity of the virus, must be provided to the recombinant virus by a helper virus or helper cell line, in other words, a complementing or packaging cell line.
BE2017 / 5910
Assistant viruses
Depending on the adenoviral gene content of the viral vectors used to carry the minigene, an assistant adenovirus or a fragment of non-replicating virus may be used to provide enough adenovirus gene sequences necessary to produce a containing the selected minigene viral particle. . A non-transfected cell assistant adenoviral vector contains adapted, document.
adapted, recombinant infectious virus, useful assistants, sequences present and / or not packaging in adenovirus genes in the construction of expressed by the line which the vector is
In one embodiment, the virus is the or
A defective cell for replication and adenoviral genes besides, such as used sequences described in the helper virus is, in combination with an expressing El
A virus assisting a reporter gene. A (and optionally optionally present in a line additionally containing a number of these reporter genes are known in the art and well described herein. The presence of a reporter gene on the helper virus which is different from the transgene on the adenoviral vector allows the adenoviral vector controlled.
separation and the assistant virus be independently
This reporter is used to allow the between the recombinant virus obtained and the assistant virus after the purification.
BE2017 / 5910
Complementary cell lines
In a large number of circumstances, a cell line expressing the missing gene (s) which are essential for the replication and infectivity of the virus, for example human E1, can be used to transcomplement an adenoviral chimpanzee vector. This is particularly advantageous because, due to the diversity between the chimpanzee adenoviral sequences of the invention and the human adenoviral sequences encountered in packaging cells currently available, the use of human cells containing current El prevents the generation of adenoviruses competent for replication during the replication and production process.
Alternatively, if desired, it is possible to use the sequences proposed in the present invention to generate a packaging cell or cell line which expresses, at a minimum, the El gene of ChAd157 or of another adenovirus (for example a human adenovirus, for example, hAd5 El, or another ChAd El) under the transcriptional control of a promoter for expression in a selected parent cell line. Inducible or constitutive promoters can be used for this purpose. Examples of these promoters are described in detail elsewhere in this document. A parent cell is selected for the generation of a new cell line expressing any desired ChAd157 gene. Without limitation, such a parent cell line can be the HeLa line (access number ATCC CCL
2], A549 [ATCC CCL 185 access no.],
BE2017 / 5910
HEK293, KB [CCL 17], Detroit [for example, Detroit 510, CCL 72] and WI-38 [CCL 75], among others. These cell lines are available from the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209.
Such E1 expressing cell lines are useful in generating recombinant adenoviral vectors with deleted E1. Additionally, or alternatively, cell lines which express one or more adenoviral gene products, for example, EIA, E1B, E2A, E3 and / or E4, can be constructed using substantially the same procedures as those used in the generation of recombinant viral vectors. These cell lines can be used to transcomplement the adenoviral vectors carrying deletions in the essential genes that code for these products, or to provide helper functions necessary to package a virus dependent on an assistant virus (for example, an adeno virus -associated). The preparation of a host cell requires techniques such as the assembly of selected DNA sequences.
In another variant, the essential adenoviral gene products are supplied in trans by the adenoviral vector and / or the helper virus. In such a case, a suitable host cell can be selected from any biological organism, including prokaryotic (e.g. bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and cells mammal.
BE2017 / 5910
Host cells can be selected from any mammalian species including, but not limited to, cells such as A549, WEHI, 3T3, 10'1'1 / 2, HEK 293 or Per.C6 cells (both expressing functional adenoviral El) [Fallaux, FJ et al., (1998), Hum Gene Ther, 9: 1909-1917], Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblasts, hepatocytes and myoblasts derived from mammals including human, monkey, mouse, rat, rabbit, and hamster.
A particularly suitable complementation cell line is the Procell92 cell line. The Procell92 cell line is based on HEK 293 cells which express the adenoviral E1 genes, transfected with the Tet repressor under the control of the human phosphoglycerate kinase 1 (PGK) promoter, and the G418 resistance gene (Vitelli et al. PLOS One (2013) 8 (e55435): 1-9). Procell92.S is suitable for growth under suspension conditions and is useful for the production of adenoviral vectors expressing toxic proteins (www.okairos.com/e/inners.php m=00084, last accessed April 13, 2015) .
Assembly of a viral particle and transfection of a cell line
Generally, upon delivery of the vector comprising the minigene by transfection, the vector is delivered in an amount of from about 5 µg to about 100 µg of DNA, and preferably from about 10 to about 50 µg of DNA to about 1 x 10 ⁴ cells to about 1 x 10 ¹³
BE2017 / 5910 cells, and preferably around 10 ⁵ cells.
However, the relative amounts of vector DNA relative to the host cells can be adjusted, taking into account factors such as the desired vector, the delivery method and the host cells chosen.
The introduction into the host cell of the vector can be carried out by any means known in the art, including by transfection, and infection. One or more of the adenoviral genes can be stably integrated into the host cell genome, stably expressed as episomes, or transiently expressed. The gene products can all be expressed transiently, on an episome or stably integrated, or some of the gene products can be expressed stably while others are expressed transiently.
The introduction of vectors into the host cell can also be carried out using techniques known to those skilled in the art. Suitably, ordinary transfection techniques are used, for example, CaPC transfection or electroporation.
The assembly of the selected DNA sequences of the adenovirus (as well as the transgene and other elements of the vector) into different intermediate plasmids, and the use of the plasmid and the vectors to produce a recombinant viral particle are all obtained using classical techniques. These techniques include conventional cDNA cloning techniques, the use
BE2017 / 5910 of overlapping oligonucleotide sequences on the adenovirus genomes, the polymerase chain reaction, and any suitable method which produces the desired nucleotide sequence. Standard transfection and co-transfection techniques are used, for example, CaPC precipitation techniques. Other conventional methods used include homologous recombination of viral genomes, plaque spreading of virus in an agar layer, methods of measuring signal generation, and the like.
For example, after the construction and assembly of the viral vector containing the desired minigene, the vector is transfected in vitro in the presence of an assistant virus in the packaging cell line. Homologous recombination occurs between the helper and vector sequences, allowing the adenoviral transgene sequences in the vector to be replicated and packaged in the capsids of the virions, resulting in the recombinant vector viral particles. The resulting recombinant adenoviruses are useful for transferring a selected transgene to a selected cell. In in vivo experiments with recombinant virus grown in packaging cell lines, the recombinant adenoviral vectors deleted with El of this invention demonstrate utility in transferring a transgene to a non-simian mammalian cell, preferably human.
BE2017 / 5910
Transgenes
The transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which codes for a protein of interest. The coding nucleic acid sequence is functionally linked to the regulatory components in a manner that allows for transcription, translation and / or expression of the transgene in a host cell.
The composition of the transgene sequence will depend on the use to which the resulting vector is devoted. For example, the transgene may be a therapeutic transgene or an immunogenic transgene. Alternatively, a transgene sequence may include a reporter sequence, which under the effect of expression produces a detectable signal. These reporter sequences include, but are not limited to, DNA sequences encoding ßlactamase, ß-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT) , luciferase, membrane-bound proteins including, for example, CD2, CD4, CD8, hemagglutinin protein of the influenza virus, and others well known in the art, against which high affinity antibodies exist or can be produced by conventional means, and fusion proteins comprising a membrane-bound protein appropriately fused to an antigen tag domain from, inter alia, hemagglutinin or Myc. These coding sequences, when associated with regulatory elements which direct
BE2017 / 5910 their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectroscopic tests, cell sorting by FACS (fluorescent activating cell sorting assays) and immunoassays, including an enzyme immunoassay (ELISA), a radioimmunoassay (RIA) and immunohistochemistry.
In one embodiment, the transgene is a non-marker sequence encoding a product which is useful in biology and medicine, such as a therapeutic transgene or an immunogenic transgene such as proteins, RNA, enzymes, or Catalytic RNAs. Desirable RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNA, and antisense RNA. An example of a useful RNA sequence is a sequence which quenches the expression of a targeted nucleic acid sequence in the treated animal.
The transgene can be used for the treatment, for example, of genetic deficiencies, as a therapeutic product or vaccine against cancer, for the induction of an immune response, and / or for the purposes of prophylactic vaccination. As used herein, induction of an immune response refers to the ability of a protein to induce a T cell response and / or a humoral immune response to the protein.
The term prophylaxis means providing a drug in advance, which may be before exposure to a pathogen (pre-exposure prophylaxis)
BE2017 / 5910 or before the development of symptoms of a disease (post-exposure prophylaxis). The terms treatment and therapy are used interchangeably and mean drug administration during illness.
The term disease is understood to mean a disorder of a structure or function in a subject, in particular a disorder which produces specific symptoms or which affects a specific place and is not simply a direct result of a physical injury.
Regulatory elements
In addition to the transgene, the vector also includes the conventional control elements which are operably linked to the transgene in a manner which allows its transcription, translation and / or expression in a cell transfected with the plasmid vector or infected with the virus. produced by the invention. As used herein, the expression "functionally linked" sequences includes both expression control sequences that are contiguous with the gene of interest and expression control sequences that act trans or remotely to control the gene of interest.
Expression control sequences include appropriate transcription initiation, termination, promoter and amplification sequences; effective RNA processing signals such as splicing and polyadenylation signals (polyA) including polyA of the
BE2017 / 5910 rabbit beta-globin; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (for example, the Kozak consensus sequence); sequences that improve protein stability; and if desired, sequences which enhance the secretion of the encoded product. Among other sequences, chimeric introns can be used.
In certain embodiments, the post-transcriptional regulatory element of the groundhog hepatitis virus (WPRE) (Zuffrey et al. (1999) J Virol; 73 (4): 2886-9) can be functionally linked to the transgene. An example of WPRE is proposed in SEQ ID NO: 26.
A "promoter" is a nucleotide sequence that allows the binding of RNA polymerase and directs the transcription of a gene. Typically, a promoter is located in the 5 'non-coding region of a gene, near the site of the start of gene transcription. The elements of the sequence inside the promoter which function in initiating transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters of bacteria, yeast, plants, viruses, and mammals (including humans). A large number of expression control sequences, including promoters which are internal, native, constitutive, inducible and / or tissue specific, are known in the art and can be used.
BE2017 / 5910
Examples of constitutive promoters include, without limitation, the TBG promoter, the LTR promoter of Rous sarcoma virus (optionally with the enhancer), the cytomegalovirus promoter (CMV) (optionally with the enhancer of CMV , see, for example, Boshart et al., Cell, 41: 521-530 (1985)), the CASI promoter, the SV40 promoter, the dihydrofolate reductase promoter, the ß-actin promoter, the phosphoglycerol kinase (PGK), and the promoter EFla (Invitrogen).
In some embodiments, the promoter is a CASI promoter (see, for example, WO2012 / 115980). The CASI promoter is a synthetic promoter which contains part of the CMV promoter, part of the chicken beta-actin promoter, and part of the UBC enhancer. In some embodiments, the CASI promoter can include a nucleic acid sequence having a sequence identity of at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or more, with SEQ ID NO: 12. In some embodiments, the promoter comprises or consists of a nucleic acid sequence from SEQ ID NO: 12.
Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, for example, an acute phase, a state differentiation
BE2017 / 5910 particular cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources including, but not limited to, Invitrogen, Clontech and Ariad. A large number of other systems have been described and can be easily selected by a person skilled in the art. For example, inducible promoters include the zinc-inducible sheep metallothionein (MT) promoter and the dexamethasone-inducible murine tumor virus (MMTV) promoter (Dex).
Other inducible systems include the T7 polymerase promoter system (WO98 / 10088); the insect promoter inducible by
Ecdysone (No et al., Proc. Natl. Acad. Sci. USA, 93: 3346-3351 (1996)), the system repressible by tetracycline (Gossen et al., Proc. Natl. Acad. Sci. USA , 89: 5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 378: 1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol, 2 : 512-518 (1998)). Other systems include the dimer FK506, VP16 or p65 using castradiol, diphenol murislerone, the system inducible by RU486 (Wang et al., Nat. Biotech., 15: 239-243 (1997) and Wang et al., Gene Ther., 4: 432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100: 2865-2872 (1997)). The effectiveness of certain inducible promoters increases over time. In these cases, it is possible to increase the efficiency of these systems.
BE2017 / 5910 by insertion of multiple repressors in tandem, for example, TetR linked to a TetR by an IRES.
In certain embodiments, the promoter is an amplified hCMV promoter, as proposed in
SEQ ID NO: 42.
In another embodiment, the native promoter for the transgene will be used.
The native promoter may be preferred when it is desired that
Expression of the transgene mimics native expression. The native promoter can be used when expression of the transgene is to be regulated temporarily or at a certain stage of development, or in a tissue-specific manner, or in response to transcriptional stimuli. In another embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, or consensus sequences
Kozak can also be used to mimic native expression.
The transgene can be operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is desired, an active promoter in the muscle should be used. These include promoters of the genes encoding skeletal ß-actin, myosin 2A light chain, dystrophin, muscle creatine kinase, as well as synthetic muscle promoters with activities superior to those of natural promoters (see Li et al., Nat. Biotech., 17: 241-245 (1999)). Examples of tissue-specific promoters are known for the liver
BE2017 / 5910 (albumin, Miyatake et al., J. Virol., 71: 5124-32 (1997); the main promoter of the hepatitis virus
B, Sandig et al., Gene Ther., 3: 1002-9 (1996);
1 alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7: 1503-14 (1996)), bone osteocalcin (Stein et al., Mol. Biol. Rep., 24: 185-96 (1997));
bone sialoprotein (Chen et al., J. Bone Miner. Res., 11: 654-64 (1996)), lymphocytes (CD2, Hansal et al., J. Immunol., 161: 1063-8 (1998) ; the heavy chain of immunoglobulins; the chain of T lymphocyte receptors), neuronal such as the promoter of neuron-specific enolase (NSE) (Andersen et al., Cell. Mol. Neurobiol, 13: 503-15 (1993 )), the neurofilament light chain gene (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88: 5611-5 (1991)), and the neuron-specific vgf gene (Piccioli et al., Neuron, 15: 373-84 (1995)), among others.
Optionally, the vectors carrying transgenes encoding immunogenic or therapeutically useful products may also include selective markers or reporter genes which may include sequences encoding resistance to geneticin, hygromicin or puromycin, among others. These selective reporters or marker genes (preferably located outside of the viral genome to be packaged in a viral particle) can be used to signal the presence of plasmids in bacterial cells, for example resistance to ampicillin. Other components of the vector may include an origin of replication.
BE2017 / 5910
These vectors are generated using the techniques and sequences proposed in this document, in conjunction with techniques known to those skilled in the art. These techniques include conventional techniques for cloning cDNA such as those described in the literature, the use of overlapping oligonucleotide sequences on adenoviral genomes, the polymerase chain reaction, and any suitable method which provides the desired nucleotide sequence .
Therapeutic products and prophylaxis
Recombinant vectors based on ChAd157 are useful for gene transfer to a human or non-simian mammal in vitro, ex vivo, and in vivo.
The recombinant adenoviral vectors described in this document can be used as expression vectors for the production of products encoded by heterologous transgenes in vitro. For example, the recombinant adenovirus incompetent for replication containing a transgene can be transfected into a complementation cell line as described above.
A recombinant adenoviral vector derived from ChAd157 provides an efficient gene transfer vehicle which can deliver a selected transgene to a selected host cell in vivo or ex vivo even when the body has neutralizing antibodies against one or more adenoviral serotypes. In one embodiment, the vector and the cells are mixed ex vivo; the infected cells are
BE2017 / 5910 grown using conventional methodologies; and the transduced cells are reinjected into the patient. These techniques are particularly well suited for the delivery of genes for therapeutic purposes and for immunization, including the induction of protective immunity.
Immunogenic transgenes
The recombinant ChAd157 vectors can also be administered in immunogenic compositions. An immunogenic composition as described in this document is a composition comprising one or more recombinant ChAdl457 vectors capable of inducing an immune response, for example a humoral response (for example antibodies) and / or cell-mediated response (for example cytotoxic T lymphocytes), against a transgene product delivered by the vector after delivery to a mammal, suitably a human. A recombinant adenovirus can comprise (suitably in any of its gene deletions) a gene encoding a desired immunogen and can therefore be used in a vaccine. Recombinant adenoviruses can be used as prophylactic or therapeutic vaccines against any pathogen for which the antigen (antigens) critical (s) for the induction of an immune response and capable (s) of limiting the diffusion of the pathogen a ( have been identified and for which the cDNA is available.
BE2017 / 5910
By the term immunogenic is meant a polypeptide which is capable of eliciting an immune response. Suitably, the immunogen is an antigen which comprises at least one epitope of B or T lymphocytes. The elicited immune response can be an antigen-specific B lymphocytes, which response produces neutralizing antibodies.
The elicited immune response may be an antigen-specific T cell response, which may be a systemic and / or local response. Antigen-specific T cell response includes a lymphocyte response
CD4 + T cells, for example a response involving CD4 + T cells expressing a plurality of cytokines, for example, IFNγ, TNFα and / or IL2.
Alternatively, or in addition, the antigen-specific lymphocyte response includes a CD8 + T-cell response, for example a response involving CD8 + T-cells expressing a plurality of cytokines, for example, IFNγ, TNFα and / or IL2.
The term immunize therefore means
Administration of an immunogen (or a polynucleotide encoding the immunogen as appropriate in the context), to elicit an immune response.
Such vaccines or other immunogenic compositions can be formulated in a suitable delivery vehicle. Generally, the doses of the immunogenic compositions are within the range defined below in the section “Method of delivery and assay”. The immunity levels of the selected gene can be monitored to determine if boosts
BE2017 / 5910 are necessary or not. After an evaluation of the antibody titers in the serum, optionally boost immunizations may be desired.
Optionally, a vaccine or immunogenic composition of the invention may be formulated to contain other components, including, for example, adjuvants, stabilizers, pH adjusting agents, preservatives and the like. Examples of adjuvants are provided below under "Adjuvants". Such an adjuvant can be administered with a first DNA vaccine coding for an antigen to improve the specific immune response of the antigen compared to the immune response generated upon sensitization with a DNA vaccine coding for the antigen only. Alternatively, such an adjuvant can be administered with a polypeptide antigen which is administered in an administration regimen involving the ChAd157 vectors of the invention (as described below under "Administration regimen").
The recombinant adenoviruses are administered in an immunogenic amount, in other words, an amount of recombinant adenovirus which is effective in an administration route to transfect the desired target cells and provide sufficient levels of expression of the gene chosen to induce an immune response. When protective immunity is provided, recombinant adenoviruses are considered to be vaccine compositions useful in the prevention of recurrent infection and / or disease.
BE2017 / 5910
The recombinant vectors described herein are expected to be very effective in inducing cytolytic T cells and antibodies to the inserted heterologous antigenic protein expressed by the vector.
Immunogens expressed by the vectors of the invention which are useful for immunizing a human or non-human animal against other pathogens include, for example, bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or a cancer cell or tumor cell. For example, immunogens can be selected from a variety of viral families. For example, the viral families against which an immune response would be desirable include Lyssaviruses such as rabies viruses, respiratory viruses such as respiratory syncytial virus (RSV) and other paramyxoviruses such as human metapneumovirus, hMPV and parainfluenza virus (PIV).
Suitable rabies antigens which are useful as immunogens for immunizing a human or non-human animal can be selected from the rabies viral glycoprotein (G), RNA polymerase (L), the matrix protein ( Μ), nucleoprotein (N) and phosphoprotein (P). The term "G protein" or "glycoprotein" or "G protein polypeptide" or "Glycoprotein polypeptide" refers to a polypeptide or protein having all or part of an acid sequence
BE2017 / 5910 amino acids of a rabies glycoprotein polypeptide. The term "L protein" or "RNA polymerase protein" or "L protein polypeptide" or "RNA polymerase protein polypeptide" refers to a polypeptide or protein having all or part of an acid sequence amines of a rabies RNA polymerase protein polypeptide. The term "protein Μ" or "matrix protein" or "protein Μ polypeptide" or "matrix protein polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of a polypeptide matrix protein of rabies. The term "protein N" or "nucleoprotein" or "protein N polypeptide" or "nucleoprotein polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of a nucleoprotein polypeptide of rabies. The term "protein P" or "phosphoprotein" or "protein P polypeptide" or "phosphoprotein polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of a phosphoprotein polypeptide of rabies.
Appropriate RSV antigens which are useful as immunogens to immunize a human or non-human animal can be selected from: fusion protein (F), binding protein (G), matrix protein (M2) and nucleoprotein (N). The term "F protein" or "fusion protein" or "F protein polypeptide" or "fusion protein polypeptide" refers to a polypeptide or
BE2017 / 5910 a protein having all or part of an amino acid sequence of an RSV fusion protein polypeptide. Similarly, the term "G protein" or "G protein polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of an RSV binding protein polypeptide. The term "protein Μ" or "matrix protein" or "protein Μ polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of an RSV matrix protein and may include the either or both of the gene products M2-1 (which may be written in this document M2.1) and M2-2. Similarly, the term "protein N" or "nucleocapsid protein" or "protein N polypeptide" refers to a polypeptide or protein having all or part of an amino acid sequence of an RSV nucleoprotein.
Two groups of human RSV strains have been described, groups A and B, mainly based on differences in the antigenicity of glycoprotein G. A large number of strains of RSV have been isolated so far, all of which are appropriate in the context of the antigens of the immunogenic combinations described in this document. Examples of strains indicated by the GenBank and / or EMBL access numbers can be found in the published US application number 2010/0203071 (W02008114149), which is incorporated into this document by way of reference for the description of the sequences of d appropriate RSV F and G proteins nucleic acid and polypeptide
BE2017 / 5910 for their use in the present invention. In one embodiment, the RSV F protein can be an ectodomain of an RSV F protein (FATM).
Examples of Μ and N proteins nucleic acids and protein sequences can be found, for example, in published US application number 2014/0141042 (WO2012 / 089833), which is incorporated into this document for the purpose of sequence description. nucleic acid and polypeptide proteins Μ and N of RSV suitable for use in the present invention.
Suitably, for its use in the present invention, a nucleic acid encodes an FRS antigen of RSV and for the Μ and N antigens of RSV. More specifically, the nucleic acid encodes an RSV FATM antigen and for the RSV M2-1 and N antigens, in which a self-cleavage site is induced between the RSV FATM antigen and RSV M2-1 and a flexible linker is included between the M2-1 and N antigens of the RSV. In one embodiment, a suitable nucleic acid encodes the polypeptide represented by SEQ ID NO: 37
In one embodiment, the immunogen can come from a retrovirus, for example from a lentivirus such as the human immunodeficiency virus (HIV). In such an embodiment, the immunogens can be from HIV-1 or HIV-2.
The HIV genome codes for a number of different proteins, each of which may be immunogenic in its entirety or in the form of a fragment when expressed by the vectors.
BE2017 / 5910 the present invention. Envelope proteins include gpl20, gp41 and gpl60 of the Env precursor, for example. Proteins other than HIV envelope proteins include, for example, internal structural proteins such as the gag and pol gene products and other non-structural proteins such as Rev, Nef, Vif and Tat. In one embodiment, the vector of the invention codes for one or more polypeptides comprising the HIV Gag.
The Gag gene is translated in the form of a precursor polyprotein which is cleaved by the protease to give products which include the matrix protein (pl7), the capsid (p24), the nucleocapsid (p9), p6 and two spacer peptides, p2 and pl, all being examples of Gag fragments.
The Gag gene gives rise to the 55 kilodalton precursor protein Gag (kD), also called p55, which is expressed from viral non-spliced mRNA. During translation, the N-terminal end of p55 is myristoylated, triggering its association with the cytoplasmic appearance of cell membranes. The membrane-associated Gag polyprotein recruits two copies of viral genomic RNA together with other viral and cellular proteins, which triggers budding of the viral particle from the surface of an infected cell. After budding, p55 is cleaved with the protease encoded by the virus (a product of the pol gene) during the viral maturation process into four smaller proteins designated MA (matrix [l7]), CA (capsid
BE2017 / 5910 [24]), NC (nucleocapsid [9]), and p6, all being examples of Gag fragments. In one embodiment, the vectors of the present invention comprise the Gag polypeptide of SEQ ID NO: 16.
Adjutants
An "adjuvant", as used herein, refers to a composition which improves the immune response to an immunogen. Examples of these adjuvants include, but are not limited to, inorganic adjuvants (e.g., inorganic metal salts such as aluminum phosphate or aluminum hydroxide), organic adjuvants (e.g. saponins, such as QS21, or squalene), oil-based adjuvants (e.g., complete Freund's adjuvant and incomplete Freund's adjuvant), cytokines (e.g., IL-1β, IL-2, IL -7, IL-12, IL-18, GM-CFS, and IFN-γ), particulate adjuvants (e.g., immune stimulation complexes (ISCOMS), liposomes, or biodegradable microspheres), virosomes, bacterial adjuvants (for example, monophosphoryl lipid A, for example monophosphoryl lipid A 3-deO-acylated (3D-MPL), or muramyl peptides), synthetic adjuvants (for example, nonionic block copolymers, analogs of muramyl peptide, or synthetic lipid A), adjuvants of synthetic polynucleotides ques (eg polyarginine or polylysine) and immune stimulating oligonucleotides containing unmethylated CpG dinucleotides ("CpG").
BE2017 / 5910
A suitable adjuvant is monophosphoryl lipid A (MPL), in particular monophosphoryl lipid A 3dé-O-acylé (3D-MPL). Chemically, it is often supplied in the form of a monophosphoryl lipid A 3-deO-acylated with 4, 5, or 6 acylated chains. It can be purified and prepared by the methods taught in GB 2122204B, this reference also describing the preparation of diphosphoryl lipid A, and variants
3-O-deacylated of it. Other purified and synthetic lipopolysaccharides have been described (US Patent No. 6005099 and EP 0729473B1; Hilgers et al., 1986, Int. Arch. Allergy. Immunol., 79 (4): 392-6; Hilgers et al., 1987, Immunology, 60 (1): 1416; and EP 0549 074 B1).
Saponins are also suitable adjuvants (see Lacaille-Dubois, Μ and Wagner H, A review of the biological and pharmacological activities of saponins. Phytomedicine vol 2 pp 363-386 (1996)). For example, the saponin Quil A (from the bark of Panama wood, Quillaja saponaria Molina, a tree from South America), and fractions thereof, are described in US Patent No. 5,057,540 and in Kensil, Crit. Rev. Ther. Drug Carrier Syst., 1996, 12: 1-55; and in EP 0362279 B1. The purified Quil A fractions are also known as immunostimulants, for example QS21 and QS17; processes for their production are described in US Patent No. 5057540 and EP 0362279 B1. QS7 (a non-hemolytic fraction of Quil-A) is also described in these references. The use of QS21 is further described in Kensil et al. (1991, J. Immunology, 146: 431-437). Of
BE2017 / 5910 combinations of QS21 and polysorbate or cyclodextrin are also known (W099 / 10008). Particulate adjuvant systems comprising QuilA fractions, for example QS21 and QS7, are described in WO96 / 33739 and WO96 / 11711.
Another adjuvant is an immunostimulatory oligonucleotide containing the unmethylated CpG dinucleotides ("CpG") (Krieg, Nature 374: 546 (1995)). CpG is an abbreviation of cytosine-guanosine dinucleotide motifs found in DNA. CpG is known as an adjuvant when administered by the systemic and mucosal routes (WO96 / 02555, EP 468520, Davis et al., J. Immunol, 1998, 160: 870-876; McCluskie and Davis, J. Immunol. , 1998, 161: 4463-6). CpG, when formulated in vaccines, can be administered in a free solution together with a free antigen (WO96 / 02555) or covalently conjugated to an antigen (WO98 / 16247), or formulated with a vector such as
Aluminum hydroxide (BrazolotMillan et al.,
Proc.
Natl. Acad. Sci.,
USA,
1998, 95:
Additives such as those described above can be formulated in conjunction with vectors, such as liposomes, oil-in-water emulsions, and / or metal salts (including aluminum salts such as
Aluminum hydroxide).
For example, 3D-MPL can be formulated with aluminum hydroxide (EP 0689454) or oil-in-water emulsions (WO95 / 17210); QS21 can be formulated with liposomes containing cholesterol (WO96 / 33739), oil-in-water emulsions
BE2017 / 5910 (WO95 / 17210) of alum (WO98 / 15287); CpG can be formulated with alum (Brazolot-Millan, supra) or with other cationic vectors.
Combinations of adjuvants can be used in the present invention, in particular a combination of monophosphoryl lipid A and a saponin derivative (see, for example, WO94 / 00153; WO95 / 17210; WO96 / 33739; WO98 / 56414; WO99 / 12565; WO99 / 11241), more particularly the combination of QS21 and 3D-MPL as described in WO94 / 00153, or a composition in which QS21 is deactivated in liposomes containing cholesterol (DQ) as described in WO96 / 33739. Alternatively, a combination of CpG plus a saponin such as QS21 is an adjuvant suitable for use in the present invention. A potent adjuvant formulation containing QS21, 3D-MPL and tocopherol in an oil-in-water emulsion is described in WO95 / 17210 and constitutes another formulation for use in the present invention. Saponin adjuvants can be formulated in a liposome and combined with an immunostimulatory oligonucleotide. Thus, suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, preferably 3D-MPL, together with an aluminum salt (for example, as described in WO00 / 23105). Another example of an adjuvant includes QS21 and / or MPL and / or CpG. QS21 can be quenched in liposomes containing cholesterol as described in WO96 / 33739.
BE2017 / 5910
Other suitable adjuvants include alkyl glucosaminide phosphates (AGP) such as those described in WO9850399 or in US Patent No. 6,303,347 (methods for preparing AGP are also described), or pharmaceutically acceptable salts of AGP such as described in patent n ° US 6,764,840. Some AGPs are TLR4 agonists, and some are TLR4 antagonists. Both are adjuvants.
62656, which is published under as reference to chain sequences the invariant chain to an expression system and the Lgene response is increased, if administered equally, in a mode of the immunogenic invariant chain transgene in a nant.
suppose to be useful as
It has been discovered (WO2007 / US 2011/0293704 and incorporated for the purpose of description of invariants) that the fusion of antigen which is composed by used for the immune vaccination against said ant: with an adenovirus. In cons realization of the invention, can be co-expressed with the viral vector ChAdl57 recombi
In another embodiment, relates to the use of the capsid (optionally a viral particle
The invention of intact or recombinant ChAdl57 or an empty capsid is used) to induce a response with immunomodulatory effect, or to improve or adjuvant a response of cytotoxic T lymphocytes against another active agent by delivery of a capsid of ChAdl57 to a subject . The capsid of ChAd157 can be administered alone or in a regimen combined with an active agent to improve the immune response against it. Advantageously,
BE2017 / 5910 the desired effect can be achieved without infecting the host with an adenovirus.
Administration regimes
Commonly, the ChAd157 recombinant adenoviral vectors will be used for the delivery of therapeutic or immunogenic molecules (such as proteins). It will be readily understood for both applications that the recombinant adenoviral vectors of the invention are particularly well suited for use in regimes involving the repeated delivery of recombinant adenoviral vectors. These regimes typically involve the delivery of a series of viral vectors in which the viral capsids are alternated. Viral capsids can be changed for each subsequent administration, or after a preselected number of administrations of a capsid of a particular serotype (eg, one, two, three, four or more). Thus, a diet may involve the delivery of a recombinant adenovirus with a first capsid, the delivery of a recombinant adenovirus with a second capsid, and the delivery of a recombinant adenovirus with a third capsid. A variety of other regimens which use the adenoviral capsids of the invention alone, in combination with each other, or in combination with other adenoviruses (which preferably do not exhibit immunological cross-reactivity), will be evident to men of career. Optionally, such a regimen may involve the administration of a recombinant adenovirus with capsids of other
BE2017 / 5910 non-human primate adenovirus, human adenovirus, or artificial sequences as described in the document.
The adenoviral vectors of the invention are particularly well suited for therapeutic regimes in which multiple deliveries of transgenes mediated by adenoviruses are desired, for example, in regimes involving re-delivery of the same transgene or in combination regimens involving the delivery of other transgenes.
These regimens may involve the administration of an adenoviral vector
ChAd157, followed by re-administration with a vector of an adenovirus of the same serotype. Particularly desirable regimes may involve the administration of an adenoviral vector ChAd157, wherein the source of the adenoviral capsid sequences of the vector administered in the first administration is different from the source of the adenoviral capsid sequences of the viral vector used in one or more subsequent administrations. For example, a therapeutic regimen involves administration of a vector of ChAd157 and repeated administration with one or more modified adenoviral vectors of the same or different serotypes.
In another example, a therapeutic regimen involves the administration of an adenoviral vector followed by repeated administration with a vector ChAd157 of the invention whose capsid is different from the capsid in the first adenoviral vector administered, and optionally
Administration
BE2017 / 5910 subsequent with another vector which is identical or, preferably, different from the source of the adenoviral capsid of the vector in the prior administration steps. These regimes are not limited to the administration of adenoviral vectors constructed using the sequences of ChAd157. In contrast, these regimens can readily use other adenoviral sequences, including, but not limited to, other adenoviral sequences comprising non-human primate adenoviral sequences, or human adenoviral sequences, in combination with the vectors ChAd157.
In another example, a therapeutic regimen may involve simultaneous (e.g. co-administration) or sequential (e.g. primo-booster) delivery of (i) one or more ChAd157 adenoviral vectors and (ii) an additional component such as non-adenoviral vectors, non-viral vectors, and / or a variety of therapeutically useful compounds or molecules such as antigenic proteins optionally simultaneously administered with the adjuvant. Examples of co-administration include homolateral co-administration and contralateral co-administration (further described below in the "Delivery and Dosage Procedures" section).
Suitable non-adenoviral vectors intended for use in simultaneous or in particular sequential delivery (for example primoimmunisation-booster) with one or more adenoviral vectors ChAd157 comprise one or more
BE2017 / 5910 poxviral vectors. Suitably, the poxviral vector belongs to the subfamily of chordopoxvirinae, more adapted to a genus in said subfamily selected from the group consisting of orthopox, parapox, yatapox, avipox (suitably canarypox (ALVAC) or fowlpox (FPV)) and molluscipox. Even more suitably, the poxviral vector belongs to the orthopox and is selected from the group consisting of vaccinia virus,
NYVAC (derived from the Copenhagen strain of modified Ankara vaccinia virus (MVA), cowpox virus and monkeypox virus.
Ideally, the poxviral vector is MVA.
"Simultaneous" administration appropriately refers to the same ongoing immune response. Preferably, the two components are administered at the same time (for example a simultaneous administration of DNA, however, one component must be administered a few minutes after (for example, during the same medical consultation or after a few hours. Reference is also made to such administration as a co-administration.
In some embodiments, co-administration may refer to the administration of an adenoviral vector, an adjuvant and a protein component. In other embodiments, co-administration refers to the administration of an adenoviral vector and another viral vector, for example a second adenoviral vector or a poxvirus such as MVA. In other embodiments, the
BE2017 / 5910 co-administration refers to the administration of an adenoviral vector and a protein component, which is optionally adjuvanted.
A boost primo-immunization regimen can be used. Primoimmunization-boost refers to two separate immune responses:
(i) an initial primoimmunization of the immune system followed by (ii) a secondary immunization or boost of the immune system several weeks or months after the establishment of the primary immune response.
Such a diet may involve the administration of a recombinant ChAd157 vector to sensitize the immune system before a second boost administration with a traditional antigen, such as a protein (optionally co-administered with the adjuvant), or a recombinant virus. carrying the sequences coding for such an antigen (for example, WO00 / 11140). Alternatively, an immunization system may involve the administration of a recombinant ChAd157 vector to stimulate an immune response to a vector (viral or DNA-based) encoding an antigen In another variant, an immunization regimen involves the administration of a protein followed by a boost with a recombinant ChAd157 vector encoding the antigen. In one example, the primoimmunization-boost regimen can provide a protective immune response against the virus, bacteria, or other organism from which the antigen originates. In another embodiment, the primo-injection-boost regimen provides a therapeutic effect which can be measured by
BE2017 / 5910 using standard tests to detect the presence of the condition for which the therapy is administered.
Preferably, a boost composition is administered about 2 to about 27 weeks after the administration of the primoimmunization composition to the subject. Administration of the boost composition is accomplished using an effective amount of a boost composition containing or capable of delivering the same antigen as, or an antigen different from, that administered by the primary immunization vaccine. The boost composition can be composed of a recombinant viral vector derived from the same viral source or from another source. Alternatively, the boost composition may be a composition containing the same antigen as that encoded in the primary immunization vaccine, but in the form of a protein, the composition inducing an immune response in the host. The main requirements of the boost composition are that the antigen of the composition is the same antigen, or an antigen exhibiting cross-reactivity, as that encoded by the sensitizing composition.
Low cross-reactivity between neutralizing antibodies against ChAdl57 and certain other adenoviral vectors, for example ChAdl55, is beneficial in contexts where multiple administrations of vectors are required. Multiple administrations can be used for the separate delivery of different transgenes (e.g., coding for immunogens
BE2017 / 5910 associated with different medical indications) or the delivery of the same or similar transgenes (for example, in a primoimmunization-boost regimen to increase the immune response against a medical indication
Consequently, the invention relates to a recombinant adenoviral vector of the invention coding for a transgene, for its administration to a subject which has been previously exposed to a recombinant adenoviral vector which does not comprise a fiber of ChAd157, or the functional derivative of this, as described in this document (for example, does not include a fiber, hexon or penton of ChAd157 as described in this document, for example a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55, in particular a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55). In particular, the invention relates to a recombinant adenoviral vector of the invention coding for a transgene for its administration to a subject who has already received a recombinant adenoviral vector which does not comprise
ChAdl57, or the functional derivative thereof, as described in this document (for example, does not include a fiber, hexon or penton of ChAdl57 as described in this document, for example a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55, in particular a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55). Suitably, the
BE2017 / 5910 recombinant adenoviral vector which does not comprise a ChAdl57 fiber is a vector which exhibits a low cross-reactivity with ChAdl57. In one embodiment, the recombinant adenoviral vector which does not comprise a fiber of ChAd157 encodes a transgene directed against a different indication or medical indications compared to the recombinant adenoviral vector of the transgene of the invention. In another embodiment, the recombinant adenoviral vector which does not comprise a ChAd157 fiber codes for a transgene directed against the same or the same medical indications as the recombinant adenoviral vector of the transgene of the invention (for example, the same transgene ).
The invention further relates to a recombinant adenoviral vector of the invention encoding a transgene for its administration to a subject which may be (in other words, which is intended to be or is expected to be either) then exposed to a recombinant adenoviral vector which does not comprise a fiber of ChAd157, or a functional derivative thereof, as described in the present document (for example, does not comprise a fiber, hexon or penton of ChAdl57 as described in the present document, for example a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55, in particular a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55). In particular, the invention relates to a recombinant adenoviral vector of the invention encoding a transgene for administration to a subject who can then
BE2017 / 5910
to receive a recombinant adenoviral vector who does not understands not fiber of ChAdl57, or of derivative functional of this one, Phone that describes in the present document (by example, born understands not of fiber, of hexon or from penton of ChAdl57 such as describes in the
example a vector adenoviral present document, by recombinant comprising a fiber, a hexon and / or a penton of
ChAdl55, in particular a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55). Suitably, the recombinant adenoviral vector which does not comprise a ChAd157 fiber is a vector which exhibits a low cross-reactivity with ChAd157. In one embodiment, the recombinant adenoviral vector which does not include fiber
ChAd157 codes for a transgene directed against a different indication or medical indications compared to the recombinant adenoviral vector of the transgene of the invention. In another embodiment, the recombinant adenoviral vector which does not comprise a ChAd157 fiber codes for a transgene directed against the same or the same medical indications as the adenoviral vector of the transgene of the invention (for example, the same transgene) .
The present invention therefore relates to a method for eliciting an immune response in a subject, said method comprising:
(a) the administration to the subject of a recombinant adenoviral vector of the invention coding for a first transgene; and (b) administering to a recombinant adenoviral vector which does not include fiber
BE2017 / 5910
ChAd157, or a functional derivative thereof as described in this document, the vector encoding a second transgene;
wherein steps (a) and (b) can be undertaken in either order and the first and second transgenes can be the same or different.
The first and second transgenes will typically code for immunogens which are useful for immunizing a human or non-human animal against a pathogen such as bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or against a cancer cell or a tumor cell. The first and second transgenes can code for the same immunogens or for different immunogens. When coding for different immunogens, these can be directed against the same pathogen or the same cancer cell or the same tumor cell or a pathogen or a different cancer cell or tumor cell.
Consequently, the invention also relates to a method of prophylaxis or treatment of a subject, said method comprising:
(a) the administration to the subject of a recombinant adenoviral vector of the invention coding for a first transgene coding for an immunogen which is useful for immunizing a human being or a non-human animal against a pathogen such as bacteria, fungi , parasitic microorganisms or multicellular parasites that infect vertebrates
BE2017 / 5910 human and non-human, or against a cancer cell or a tumor cell; and (b) administering to a recombinant adenoviral vector which does not include fiber
ChAd157, or a functional derivative thereof as described herein, the vector encoding a second transgene encoding an immunogen which will be useful for immunizing a human or non-human animal against a pathogen such as bacteria, fungi, parasitic microorganisms or multicellular parasites that infect human and non-human vertebrates, or against a cancer cell or tumor cell;
in which can be undertaken in either order.
The recombinant adenoviral vector which does not include
ChAdl57, or a functional derivative thereof as described in this document, does not suitably include ChAdl57 fiber, ChAdl57 hexon or does not include ChAdl57 fiber or fiber , for example, of ChAdl57, hexon of ChAdl57 or functional derivatives thereof having at least 98% identity with them.
The recombinant adenoviral vector which does not comprise a fiber of ChAd157, or of a functional derivative thereof as described in the present document can be a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAd155, in particular a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55.
BE2017 / 5910
As has been mentioned, a recombinant adenoviral vector of the invention can be used for the delivery of therapeutic or immunogenic molecules together with a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAd155. The recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 will comprise a fiber, a penton and / or a hexon according to SEQ ID NO: 7, 9 and 11, in particular a fiber, a penton and a hexon according to SEQ ID NO: 7, 9 and 11.
By the term low cross-reactivity is meant that immunization with a first vector does not cause a noticeable response of neutralizing antibodies against a second vector, in other words does not have a considerable impact on the immunological potency of the second vector. The responses of neutralizing antibodies can be determined with methods analogous to those of Example 7 proposed in this document. Desirably, immunization with a first vector elicits twice a neutralization titer which is on average less than 50% of the level caused by immunization with the second vector, for example less than 75%, suitably less than 90%.
By the term "subject" is meant any animal, suitably a mammal, and in particular a human being.
Method of delivery and dosage
The vector can be prepared for administration by suspension or dissolution in a vector
BE2017 / 5910 pharmaceutically or physiologically acceptable such as an isotonic saline solution; a solution of isotonic salts or other formulations which will be obvious to those skilled in the art. The suitable vector will be obvious to those skilled in the art and will depend largely on the route of administration. The compositions described herein can be administered to a mammal in a sustained release formulation using a biocompatible biodegradable polymer, or by on-site delivery using micelles, gels and liposomes.
In some embodiments,
The recombinant adenovirus of the invention is administered to a subject by intramuscular injection, by intravaginal administration, by intravenous injection, by intraperitoneal injection, by subcutaneous injection, by epicutaneous administration, by intradermal administration, by nasal administration or by oral administration.
Sublingual administration may also be of interest.
If the therapeutic regime involves the coadministration of one or more adenoviral vectors ChAd157 and another component, each formulated in different compositions, they are favorably administered co-locally at or near the same site. For example, the components can be administered (for example, via a route of administration selected from the intramuscular, transdermal, intradermal, subcutaneous route) on the same side or at the same end

BE2017 / 5910 (“co-lateral” administration) or at opposite sides or opposite ends (“contralateral” administration).
The dosages of the viral vector will mainly depend on factors such as the condition treated, the age, weight and health of the patient, and may therefore vary depending on the patient. For example, a dose of the therapeutically effective viral vector for veterinary use or for an adult human being generally contains
10 ⁵ x 10 ¹⁵ viral particles, for example from
1.5
2.5 a
10 ⁸
10 ⁸ ,
X 10 ¹⁰ ,
X 10 ¹¹ , vector x 10 ¹² (for example, x 10 ⁸ , 2.5 x 10 ⁸ ,
10 ⁹ , 1.5 x
10 ⁹ , 2.5 X
10 ⁹ , 5 X 10 ⁹ , 1 X 10 ¹⁰ ,
2.5 X 10 ¹⁰ ,
X 10 ⁿ , 1
X 10 ¹²
10 ¹⁰ ,
X 10 ¹¹ 1.5 X 10 ¹¹ , viral to be administered may
X 10 ⁷ varies plate
X 10
2.5 X at a dose which
typically 1 x 10 ⁵ at 1 x 101 ° forming units s (UFP), for example 1 x 10 ⁵ UFP, 2.5 x 10 ⁵ UFP, ⁵ UFP, 1 x 10 ⁶ UFP, 2, 5 x 10 ⁶ UFP, 5 x 10 ⁶ UFP _ó 1 UFP, 2.5 x 10 ⁷ UFP, 5 X 10 ⁷ UFP, 1 x 10 ⁸ UFP, 10 ⁸ UFP, 5 x 10 ⁸ UFP, 1 X 10 ⁹ UFP, 2.5 x 10 ⁹ UFP,
The
X 10 ¹⁰ UFP.
doses will vary in x 10 ⁹ PFU, or depending on the size of the animal and the route of administration.
For example, a suitable human or veterinary dose (for an animal of approximately 80 kg) for intramuscular injection is in the range of approximately
10 ⁹ to about 5 x 10 ¹² particles per ml, for a single site. Optionally, multiple administration sites can be used.
In another example, an appropriate veterinary or human dose may be in the range of about
BE2017 / 5910
X 10 ¹¹ to approximately 1 x 10 ¹⁵ particles for an oral formulation.
The viral vector can be quantified by quantitative PCR analysis (Q-PCR), for example with primers and a probe designed on the region of the CMV promoter using as standard curve a serial dilution of plasmid DNA. containing the vector genome with the expression cassette comprising the HCMV promoter. The number of copies in the test sample is determined by the parallel line analysis method. Alternative methods for quantifying the vector particles can be an analytical HPLC method or a spectrophotometric method based on A260 nm.
An immunologically effective amount of a nucleic acid may suitably be between 1 ng and
100 mg.
For example, an appropriate amount may be from pg to 100 mg. An appropriate amount of
The particular nucleic acid (eg, vector) can be readily determined by one of skill in the art.
Examples of effective amounts of a nucleic acid component may be between 1 ng and 100 pg, for example between 1 ng and 1 pg (for example, 100 ng1 pg), or between 1 pg and 100 pg, for example 10 ng , 150 ng, 100 ng, 150 ng, 200 ng, 250 ng, 500 ng, 750 ng, or 1 pg. Effective amounts of a nucleic acid can also include from 1 pg to 500 pg, for example between 1 pg and 200 pg, for example between 110 and 100 pg, for example 1 pg, 2 pg, 5 pg, 10 pg, 20 pg, 50 pg, 75 pg, 100 pg, 150 pg, or 200 pg. Alternatively, a
BE2017 / 5910 example of an effective amount of a nucleic acid can be between 100 pg and 1 mg, for example from 100 pg to 500 pg, for example, 100 pg, 150 pg, 200 pg, 250 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg or 1 mg.
Generally, a human dose will be a volume between 0.1 ml and 2 ml. Thus, the composition described in this document can be formulated in a volume, for example 0.1, 0.15, 0.2, 0.5, 1.0, 1.5 or 2.0 ml of human dose by individual or combined immunogenic component.
A person skilled in the art can adjust these doses, depending on the route of administration and the therapeutic or vaccine application for which the recombinant vector is used. The levels of expression of the transgene, or for an adjuvant, the level of circulating antibody, can be monitored to determine the frequency of administration of the dose.
If one or more awareness and / or booster steps are used, this step may include a single dose that is administered on an hourly, daily, weekly or monthly, or annual basis. For example, mammals can receive one or two doses containing from about 10 pg to about 50 pg of plasmid in a vector. The amount or site of delivery is desirably selected based on the identity and condition of the mammal.
Therapeutic levels of, or the level of immune response against, the protein encoded by the
BE2017 / 5910 selected transgene can be monitored to determine the need, if any, for recalls. After evaluation of the CD8 + T cell response, or optionally, antibody titers in serum, optionally booster immunizations may be desired. Optionally, the ChAd157 recombinant adenoviral vectors can be delivered in a single administration or in different combined regimens, for example, in combination with a regimen or course of treatment involving other active ingredients or in a regimen comprising a primoimmunization and a booster.
The present invention will now be described in more detail by means of the following nonlimiting examples.
EXAMPLES
Example 1: isolation of ChAdl57 and construction of vector
29 different types of wild type chimpanzee adenovirus were isolated from young healthy chimpanzees housed in European facilities using standard procedures as described in Colloca et. al. Sei Transi Med. 2012 Jan 4; 4 (115): 115ra2 and W02010 / 086189, which is thus incorporated into the present document by way of reference for the purposes of description of the isolation and characterization techniques of adenovirus.
The 29 wild-type viruses were then pooled into a pool; the viral genome of the pool was cloned by homologous recombination in BJ5183 cells
BE2017 / 5910 by E. coli using a BAC shuttle to create a vector minibank carrying the El region deletion. The vector minibank ΔΕ1 was transfected into a Procell 92 cell line; vectors saved in series were transplanted for 16 passages of infection. In passage 16, viral DNA from the amplified vector was prepared and cloned by homologous recombination in E. coli BJ5183 cells using a plasmid shuttle. The prevalent vector species was identified as the vector ChAdl57AEl and then modified to include the following additional modifications to the vector backbone:
a) deletion of the E4 region (from pb 34413 to pb 37127) of the ΔΕ1 virus;
b) insertion of E4orf6 derived from human Ad5.
1.1: Generation of the ΔΕ1 mini-bank
The pool of 29 wild-type viruses was used to obtain a grouped viral genome. The grouped viral genome was cloned into a BAC vector by homologous recombination in a strain of E. coli BJ5183 co-transformed with a grouped viral DNA and the BAC shuttle of subgroup C (# 1365) (SEQ ID NO: 14).
As shown in the diagram in FIG. 2, the shuttle of subgroup C is a BAC vector dedicated to the cloning of ChAd belonging to species C and therefore contains the pIX gene and DNA fragments derived from the right and left ends (including right and left ITRs) of ChAd species C.
The BAC shuttle of species C also contains an RpsL-Kana cassette inserted between the left end
BE2017 / 5910 and the pIX gene. In addition, an Amp-LacZ-SacB selection cassette, flanked by the IScel restriction sites, is present between the pIX gene and the right end of the viral genome. In particular, the BAC shuttle includes the following elements: left ITR: bp 27 to 139, hCMV cassette (tetO) RpsL-Kana: pb 493 to 3396, pIX gene: pb 3508 to 3972, IScel restriction sites: pg 3990 and 7481 , an Amp-LacZ-SacB selection cassette: pb 4000 to 7471, right ITR: pb 7805 to 7917. hCMV (tetO) is available in SEQ ID NO: 37.
The BJ5183 cells were co-transformed by electroporation with the pool of purified viral DNAs and with the shuttle vector BAC of subgroup C digested with the restriction enzyme IScel before purifying them from the gel. The homologous recombination which occurs between the pIX gene and the straight ITR sequences (present at the ends of the linearized DNA of the BAC shuttle of species C) and of the homologous sequences present in the grouped viral DNA has led to the insertion of different genomic DNAs into the BAC shuttle vector. At the same time, the viral regions sE1 were deleted and replaced by the RpsL-Kana cassette, generating BAC / minibankAEl / TetO hCMV RpsL-Kana.
1.2: Amplification of the ΔΕ1 minibank in the Procell 92 cell line and cloning of the vector ChAdl57AEl
The ΔΕ1 minibank was digested with Pmel and used to transfect the Procell 92 packaging cell line, in order to save the bank.
BE2017 / 5910 of different bulk viruses. Ten days after transfection, the cells were harvested and the cell lysate was subjected to three cycles of freezing (70 ° C) and thawing (+ 37 ° C), clarified by centrifugation at 2000 rpm then it was used to infect fresh cells. 16 rounds of virus amplification were carried out in order to select the viral species for propagation efficiency in Procell92 cells. The virus (s) were purified in passage 16 by two CsCl gradient centrifugations and the viral DNA was extracted and then cloned by homologous recombination in E. coli BJ5183 cells using a plasmid shuttle. In more detail, BJ5183 cells were co-transformed with purified viral DNA and the subgroup C plasmid shuttle (SEQ ID NO: 38). As shown in the diagram in FIG. 3, the plasmid shuttle of subgroup C is a plasmid vector dedicated to the cloning of ChAd belonging to species C and therefore contains the DNA fragments derived from the right and left (including right and left ITRs) of ChAd species C.
Homologous recombination between the DNA sequences of the left and right ITRs present at the ends of the plasmid shuttle of subgroup C (digested with PshAI / Ndel / Xbal) and the viral genomic DNA allowed its insertion into the plasmid vector. . 30 different clones were amplified and analyzed by restriction analysis; 9 different species have been identified. Nineteen clones / 30 have
BE2017 / 5910 presented the same restriction profile and represented the predominant species; one of these clones was selected and identified as pChAd! 57AEl TetO hCMV RpsL-Kana # 1551 (SEQ ID NO: 15).
1.3: Construction of ChAdl57 ΔΕΙ / TetO hCMV GAG
The GAG cassette (GAG polynucleotide sequence SEQ ID NO: 16) was cloned into a linearized pre-adeno acceptor vector via homologous recombination in E. coli by exploiting the homology existing between the HCMV promoter and the polyA sequences of BGH ( SEQ ID NO: 39).
Plasmid pARS CV32TetOhCMV GAG was cleaved with Spel and SphI to excise the 2.44 Kb fragment containing the HCMV promoter with tetO, HIV-GAG and the polyA sequence of BGH.
The 2.44 kB HIV-GAG fragment was cloned by homologous recombination into the acceptor vector pChAdl57 ΔΕΙ / TetO hCMV RpsL-Kana (# 1551) (digested by SnabI) carrying the RpsL-Kana selection cassette under the control of HCMV and BGHpA. The construction obtained was the vector pChAdl57 ΔΕΙ / TetO hCMV GAG # 1557 (SEQ ID NO: 17).
The structure of the plasmid carrying the GAG of ChAd157 is reported in FIG. 4.
1.4: Construction of ChAdl57 ΔΕ1Ε4 Ad5E4orf6 / TetO hCMV
RpsL-Kana # 1594
We then modified the vector ChAdl57AEl so that it carries the following modifications in the skeleton:
BE2017 / 5910
a) deletion of the E4 region (from pb 34413 to pb 37127) of the ΔΕ1 virus;
b) insertion of E4orf6 derived from human Ad5.
A deletion of the E4 region from nucleotide 34413 to 37127 (coordinates of the vector sequence ΔΕ1) was introduced into the vector backbone by replacing the native region E4 with the coding sequence of Ad4 E4orf6 using a strategy involving several stages of cloning and homologous recombination in E. coli. The E4 coding region was completely deleted while the native E4 promoter and the polyadenylation signal were retained. To this end, a shuttle vector was constructed to allow insertion of Ad5orf6 by replacing the E4 region native to ChAd157 by homologous recombination in E. coli BJ5183 as detailed below.
- Construction of pARS SpeciesC Ad5E4orf6-1: DNA containing Ad5orf6 was obtained by PCR using Ad5 DNA as a template, with the oligonucleotides: 5'ATACGGACTAGTGGAGAAGTACTCGCCTACATG-3 '(SEQ ID NO: 18) and 5'-ATACGGAAGATCTAAGACTTCAGGAAATATGACTAC-3 '(SEQ ID NO: 19). The PCR fragment was digested with BglII and Spel and then cloned into the pARS Species C RLD-EGFP shuttle digested with BglII and Spel, generating the plasmid pARS Species C Ad5orf6-1.
- Construction of pARS Species C Ad5E4orf6-2:
A 144 bp DNA fragment containing the fiber E4 polyA (from bp 34269 to bp 34412 of the vector ChAdl57AEl) was amplified by PCR using the plasmid pChAd! 57 ΔΕΙ / TetO hCMV as a template.
BE2017 / 5910
RpsL-Kana (# 1551) with the following oligonucleotides: 5'-ATTCAGTGTACAGGCGCGCCAAAGCATGACACTGATGTTCATTTC-3 '(SEQ ID NO: 20) and 5'ACTAGGACTAGTTATAAGCTAGAATGGGGCTTTGC-3' (SEQ ID NO: 21). The PCR fragment was digested with BsrGI and Spel and then cloned into pARS SubGroupC Ad5orf6-1 digested with BsrGI and Spel, generating the plasmid pARS SpeciesC
Ad5orf6-2 (SEQ ID NO: 40).
The plasmid pARS SpeciesC was then used
Ad5orf6-2 obtained to replace E4 by Ad5orf6 in skeleton of ChAdl57. To this end, the plasmid pChAdl57AEl TetO hCMV RpsLKana # 1551 was digested with Pad and co-transformed in cells BJ5183 with the plasmid pARS SpeciesC Ad5orf6-2 digested with BamHI / AscI, to obtain the preadeno plasmid pChAdl57 AElE4_Ad5E4orfM / T -Kana (# 1594) (SEQ ID NO: 22).
1.5: Construction of ChAdl57AElE4 Ad5E4orf6 / TetO hCMV RG # 1559.
The expression cassette for rabies viral glycoprotein (RG) (polynucleotide sequence for rabies glycoprotein SEQ ID NO: 23) was cloned into a pre-adeno acceptor vector linearized by homologous recombination in E. coli by exploitation. of the homology existing between the HCMV promoter and the polyA sequences of BGH.
Plasmid pvjTetOhCMV-bghpolyA_RG was cleaved with Spel and AsiSI to excise the 2.59 Kb fragment containing the HCMV promoter with tetO, RG and the polyA sequence of BGH.
BE2017 / 5910
Who cloned the R fragment 3 of 2.59 kB obtained by homologous recombination in the vector acceptor pChAdlS AE ' LE4_Ad5E 4 orf6 / TetO hCMV RpsL-Kana (# 1594) carrying the selection cassette : ^_tion:: RpsL-Kana under the control of HCMC and BGH] gA. VS > n linearized the plasmid ac preAd piper with The endonuclease of restriction SnaBI. The construction iction obtained was the
vector pChAdl57 AElE4_Ad5E4orf6 / TetO hCMV -RG # 155 9 (SEQ ID NO: 24).
0 The structure of the plasmid carrying the RG of ChAd157 is reported in .figure 6.
Example 2: Vector production
The productivity of ChAd'157 was evaluated in comparison to ChAdl9 and ChAdlSS in the Procell92 cell line.
2.1: Production of vectors comprising the Gag transgene of HIV
2Q- We saved ChAdl57 / GAG, ChAdl.9 / GAG, ChAdlS5 / GÂG (the vectors ChAdl-57, ChAdl9 and ChAdlSS expressing a Gag transgene of HIV) and we amplified them in Procell 92; the lysates were used to infect a T25 bottle of Procell 92 grown in a monolayer with each vector. A multiplicity of infection (MOI) of 300 pv / cell was used and the infections were carried out in the presence of tetracycline because ChAd19 / 'GAG did not have transcriptional control mediated by .1 insertion of the operator
TetO in the hCMV promoter. The infected cells were harvested when a complete cytopathic effect
B E2017 / 5910 was obvious. (48 hours after infection for ChAdl57 / GAG and ChAdl55 / GAG and 5 days after infection for ChAdl9 / GAGj; the viruses were released from the infected cells by three cycles of § leaveiatio.n / thaw.iön (-70 ° C to 37 ° C), then the lysate was clarified by centrifugation. The clarified lysates were quantified by quantitative PCR analysis with primers and a probe complementary to the region of the oligonucleotide promoter and the same as neither
CMV.
The following:
sequence
CMVfor
5 '
CATCTACGTATTAGTCATCGCTATTACCA “3 '(SEQ ID
NO:
CMViev 5 '~ GACTTGGAAATCCCCGTGAGT-3' (SEQ ID
NO;
CMVFAM-TAMRA 5'-ACATCAATGGGCGTGGATAGCGGTT probe
3 '(SEQ sequence 7900 ABI Prism from Applied Biosystem).
The volumetric titers obtained (pv / ml) measured on clarified lysates and the specific productivity expressed, in viral particles per cell (pv / cell) are given in table 1 below.
Table 1: Productivity of the GAG vector.
Vector Productivityvolumetric(pv / ntl) total pv Specific cell productivity (pv / cell) ChAdl 5 7 / GAG 4, 61Ε1Ό9 2.30E + 10 7.68E + 03 ChAdl55 / GAG 5.42E + 09 2.71E + 10 9.04E + 03 ChAdl9 / GAG 4.80E + 08 2,4ÖEL09 8.00Ε4Ό2
2.2: Production of vectors comprising an RG transgene
BE2017 / 5910 assess the productivity of Procell cells from RG vaccine vectors in
9.2 grown in suspension.
ChAdl55 / RG in
ChAdl57 / RG
The experience in this case was parallel by cell procell infection of 5 x 10 ⁵ cells / ml.
multiplicity of infection harvested cells infection; the infected with three then we clarified to 1 o r s gu an t i f ied 1 e s virus and
One at a density used a (ME ..) of 300 pv / cell. It was infected 4 days after the cells were freed from freeze / thaw cycles the lysate by centrifugation. We have clarified by
QPCR such as a c i-u of s u s.
The volumetric productivity and the specificity of the cells are given in below.
productivity table 2 table 2: Productivity of the GR vector.
Vector Volumetric productivity (pv / ml) total pv Specific cell productivity (pv / cell) ChAdl57 / RG 9.39E + 09 4,6.9E + L1 1.88E + 04 ChAdlS5 / RG 1.41E + 10 7.04E + 11 2.81E + 04
E xempl _3_: _n i v c a u d d expr s s i o n__d des trans g ènes
3.1: Level of ex pres s ion of. HIV gag ransgene
The expression levels were compared in parallel experiments by infection of HeLa cells with the vectors ChAdl9, ChAdlSS and ChAdlS including a Gag transgene from HIV.
100
BE2017 / 5910
HeLa cells were seeded in 35 mm dishes and infected with the purified viruses ChAdl-9 / GAG, ChAdl-57 / GAG and ChAd3.55 / GAG using an MOI “250 pv / cell. Supernatants from infected HeLa cells were harvested 48 hours after infection, and the production of secreted HIV GAG protein was quantified using a commercially available ELISA kit (HIV ~ 1 p24 ELISA Kit, PerkinElmer Life Science.). The quantification was carried out according to the manufacturer's instructions using a calibration curve for the HIV-1 p24 antigen.
The results, expressed in pg / ml of the GAG protein, are illustrated in FIG. 7.
1.5 3.2: Level of expression of the RG transgene
A western blot analysis was also carried out to evaluate the expression of the rabies glycoprotein supplied by the vector ChAdl57 / RG in comparison with the vector ChAdl-55 / RG. To this end, HeQ cells were seeded in 35 mm dishes and infected with purified viruses ChAdl5.7 '/ RG and ChAdl55 / RG using an MOI == 250 pv / cell. We. harvested the cell lysates 48 hours after infection and the level of expression of the transgenes was evaluated by reducing SDS-PAGE followed by analysis, by western blot.
Equivalent amounts of protein extracts were loaded onto reducing SDS gels; after separation by electrophoresis, the proteins were transferred to a nitrocellulose membrane for probing with a polyclonal apin anti-GP (cat. No.
BE2017 / 5910
101
RBVGP11-S "Diagnosis, diluted to 1/1000}. After incubation with the primary antibody, the membrane was washed and incubated with a secondary antibody to horseradish peroxidase (HRP).
Finally, the chemiluminescence assays were developed using detection reagents for enhanced chemiluminescence (ECL) (W3252282 PIERCE). The western blot results are shown in Figure 8.
A band of approximately 57 kD indicated by the arrow was revealed by the anti-GP polyclonal antibody, which corresponds to the expected weight of the rabies glycoprotein,
The result demonstrates that the level of expression of the vector ChAd157 appears comparable to that provided by CtAd155.
EXAMPLE 4 Evaluation of the Immunological Power by Immunization Experiments in Mice. 4.1 1 I. Immunogenicity of ..... Vectors _______ Comprising the Gag Transgene of HIV
Vector immunogenicity was assessed
ChAdl57 / GAG in parallel with ChAdl55 / GAG and ChAdl9 / GAG in BALB / c mice (6 per group). The experiment was carried out by injection of 10 intramuscular viral particles. The T cell response was measured 3 weeks after immunization with ELXSpot (enzyme-linked immuno spot ') anti i-erfer ~ v (IFN-y) using a GAG-specific CD8 + T cell epitope mapped to BALB / c mice.
The results obtained are reported in FIG. 9,
BE2017 / 5910 expressed in the form of cells secreting .1'IFNy (SCF) by .million splenocytes.
Each point represents the response of a single mouse, and the line corresponds to the geometric mean of each dose group. The frequency of mice positive for the immunodominant CD8 peptide is presented on the X axis.
4.2. immunogenicity of vectors comprising the transgene
RG
The immunological power of ChAdl57. / RG et. ChAdl55 / RG in BALB / c mice. The two vectors were injected intramuscularly with doses of 10 ⁷ and 10 ^e vp. Splenocytes from immunized mice were isolated seven weeks after vaccination and analyzed by anti-IFNY ELISpot (Figure 10), using RG peptide pools as the antigen.
The levels of the immune response were reduced, in phase with a reduced dose, as expected.
In addition, the vector ChAdlSSRG induced a T cell response greater than ChAdl57 RG, - although they were not significantly different (Figure 10).
EXAMPLE 5 Evaluation of the Infectivity · L Infectivity of vectors comprising the Gag transgene of HIV
The infectivity of purified viruses was assessed in adherent Pro.cell 92 cells using an antibody against the adenovirus hexon protein to visualize cells infected with
Ί03
B E2017 / 5910 immunocytochemical, 1 / antibody against the protein hexon recognizes this end, we have Procel.192 cells in s [j lacquers with one well and we infected them: in duplicate with the vectors
ChAdl57 / GAG and ChAdl55 / GAG and using a pv / cell MOI
Forty-eight hours after infection, we are cold methan0: 1 and then fixed the
1st brand
I incubated the labeled cells with a secondary antibody conjugated to horseradish peroxidase and the detection was carried out using a commercially available kit VECTOR NOVARED Substrate Kit (SKM800).
Detection is performed when the marker, the horseradish peroxidase enzyme, reacts with the DAB substrate, resulting in a brown product. The dark brown labeled cells were then quantified by optical 2Q microscopy and the infectious titer was calculated. The results are presented in the table below.
Virus Pv / ml Ifu / ml R (pv / ifu) ChAdl55 GAG 1.32E + 11 l, 58E + 09 84 ChAdl57 GAG 1.17 ELU 1.23E + 09 95 ChAdl 9 GAG 4, 46E + 10 3.86E108 116
naked virus infectivity
ChAdl55 and ChAdl57 was comparable and superior to that of
ChAdl9.
BE2017 / 5910
5.2 Infectivity of. vectors containing RG transgendered infectivity of purified viruses
ChAdl57 / RG and ChAdl55 / RG in adherent Procell 92 cells by immunostaining of hexon as reported above. The results: are presented in the table below of s or s.
Virus Pv / ml Xfu / ml R (pv / ifu) ChAdl55 / RG 4.2377.1 4.067 + 09 104 ChAdl57 / RG 1, 97E + .11 1.467 + 09 133
The result demonstrated that the infectivity of the ChAdlSS and ChAdl57 viruses was comparable.
h Example; _6: evaluation_of the cross neutralization between the vectors of ChAdl55 and ChAdl57
6.1 In vivo test to determine if the GhAdlSS and ChAdl57 vectors are different serotypes
Cross neutralization between the vectors ChAdlSS and ChAdl57 was evaluated in BALB / c mice (6 per group). Oh pre-immunized the mice twice at week 0 and at week 3 with 10 ^s pv of ChAdlSS and ChAdl57 expressing RG or. they were given a vaccine lure made up of saline. Three weeks later, all mice were immunized with LO ⁹ pv of ChAd157 coding for HIV gag.
Groups not Pre-immunization2 X sO and s3 dose (bp) Immunization s 6 dose (bp) : 1 6 PBSChAdl57-GAG 109 .2 6 ChAdl55 “RGChAdl57-GAG 10 "
105
B E2017 / 5910
3 6 ChAdl57-RG 1W ChAdl57 ~ GÀG-
The neutralization titers against the serum pre-immunization vectors were measured at week 5 (2 weeks after the second injection) by an in vitro neutralization assay (Figure 11). Finally, we tested the response of T lymphocytes against gag on splenocytes 3 weeks after immunization with anti-IENy ELISpot, using a j; q epitope of CD 8 + T lymphocytes specific for GAG. mapped in BALB / c mice (FIG. 12) The doses of vectors used for pre-immunization were able to elicit good neutralization activities against the two Ad vectors, although j, $ only with a certain variability. The neutralizing anti-ChAdl55 antibodies do not show any cross-reaction against ChAdl57 and vice versa (Figure II) .In addition, the response of Gag-specific T cells to ChAdl57 was not affected by Here pre ·· 2Q anti ~ GhAdl55 immunity, confirming the absence of neutralization believe e (Figure 12).
Taken together, these data suggest that the ChAdlSS and ChAdl57 viruses are adenoviruses of different serotypes.
106
BE2017 / 5910

权利要求:
Claims (71)
[1]
1. Isolated polynucleotide, in which the polynucleotide codes for a polypeptide selected from the group consisting of:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 1, and (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the functional derivative has an amino acid sequence which has at least 99.8% identity over its entire length with the amino acid sequence of SEQ ID NO: 1.
[2]
2. Recombinant polynucleotide comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1, and (b) a polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, wherein the functional derivative has an amino acid sequence which has at least 99.8% identity over its entire length with the amino acid sequence of SEQ ID NO: 1.
[3]
3. Recombinant vector comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1, and (b) a polynucleotide which codes for a functional derivative of a polypeptide having the acid sequence
107
BE2017 / 5910 amino acids according to SEQ ID NO: 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO : 1.
[4]
4. Recombinant adenovirus comprising at least one polynucleotide or a polypeptide selected from the group consisting of:
(a) a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1, (b) a polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO : 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1, (c) a polypeptide having the amino acid sequence according to SEQ ID NO: 1, and (d) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the functional derivative has an acid sequence amino acids which have an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1.
[5]
5. Composition comprising at least one of the following:
(a) a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1, (b) a polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO : 1, wherein the functional derivative has an amino acid sequence which has
108
BE2017 / 5910
an identity at least 99.8% sure all his length with the acid sequence amines of SEQ ID NO : 1, (c) a polypeptide having the sequence acids amines according SEQ ID NO: 1,
(d) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over any its length with the amino acid sequence of SEQ ID NO: 1, (e) a vector according to claim 3, and (f) a recombinant adenovirus according to claim 4, and a pharmaceutically acceptable excipient.
[6]
6. Cell comprising at least one of the following:
(a) a polynucleotide which codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1, (b) a polynucleotide which codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO : 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1, (c) a polypeptide having the amino acid sequence according to SEQ ID NO: 1, (d) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1,
109
BE2017 / 5910 (e) a vector according to claim 3, and (f) a recombinant adenovirus according to claim 4.
[7]
7. Isolated adenoviral polypeptide selected from the group consisting of:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 1, and (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which the functional derivative has an amino acid sequence which has at least 99.8% identity over its entire length with the amino acid sequence of SEQ ID NO: 1.
[8]
8. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 6, in which the polynucleotide codes for a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 1, in which functional derivative has an amino acid sequence which has an identity of at least 99.8% over its entire length with the amino acid sequence of SEQ ID NO: 1.
[9]
9. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 6, in which the polynucleotide codes for a polypeptide having the amino acid sequence according to SEQ ID NO: 1.
[10]
10. Polynucleotide, vector, adenovirus, composition or cell according to claim 9, in which the polynucleotide has a sequence according to SEQ ID NO: 2.
110
BE2017 / 5910
[11]
11. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 10, further comprising a polynucleotide coding for:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which the functional derivative has an amino acid sequence which
present a identity of at least 60% all over her length with the amino acid sequence from SEQ ID NO: 3, or (at) a polypeptide having the acid sequence amines according SEQ ID NO: 5;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5, in which the functional derivative has an amino acid sequence which has an identity of at least 60% over its whole length with the amino acid sequence of SEQ ID NO: 5.
[12]
12. Polynucleotide, vector, adenovirus, composition or cell according to claim 11, further comprising a polynucleotide encoding:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which
111
BE2017 / 5910
the derivative functional has an acid sequence amines who present a identity of at least 98% on all her length with the acid sequence amines from SEQ ID NO: 3, or (at) a polypeptide having the sequence acids
amines according to SEQ ID NO: 5;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5, in which the functional derivative has an amino acid sequence which has an identity of at least 98% over its whole length with the amino acid sequence of SEQ ID NO: 5.
[13]
13. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 10, further comprising a polynucleotide coding for:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which the functional derivative has an amino acid sequence which
present a identity of at least 98% all over her length with the amino acid sequence from SEQ ID NO: 3, and (at) a polypeptide having the acid sequence amines according SEQ ID NO: 5;
or
112
BE2017 / 5910 (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5, in which the functional derivative has an amino acid sequence which has an identity of at least 98% on its entire length with the amino acid sequence of SEQ ID NO: 5.
[14]
14. Polynucleotide, vector, adenovirus, composition or cell according to claim 13, further comprising a polynucleotide encoding:
(a) a polypeptide having the amino acid sequence according to SEQ ID NO: 3;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 3, in which the functional derivative has an amino acid sequence which has an identity of at least 98% over its whole length with the amino acid sequence of SEQ ID NO: 3, and (a) a polypeptide having the amino acid sequence according to SEQ ID NO: 5;
or (b) a functional derivative of a polypeptide having the amino acid sequence according to SEQ ID NO: 5, in which the functional derivative has an amino acid sequence which has an identity of at least 98% over its whole length with the amino acid sequence of SEQ ID NO: 5.
[15]
15. Polynucleotide, vector, adenovirus, composition or cell according to any one of
BE2017 / 5910 claims 11 to 14, in which the polynucleotide comprises a sequence according to SEQ ID NO: 4.
[16]
16. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 11 to 15, in which the polynucleotide comprises a sequence according to SEQ ID NO: 6.
[17]
17. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 16, in which the polynucleotide
understands at least one of the following: (at) a 5 'adenoviral end, preferably a sequence repeated inverted terminal in 5 '(ITR)
adenoviral;
(b) an E1A adenoviral region, or a fragment of this one selected from EIA 280R and EIA 243R r (vs) an E1B or IX adenoviral region, or a fragment
of these selected from the group consisting of regions E1B_19K, E1B_55K or IX;
(d) an E2b adenoviral region; or a fragment thereof selected from the group consisting of the E2B_pTP, E2B_polymerase and E2B_IVa2 regions;
(e) an L1 adenoviral region, or a fragment of
the latter, said fragment coding for an adenoviral protein selected from the group consisting of the proteins Ll_13.6k, L1_52K and Ll_IIIa;
(f) an L2 adenoviral region, or a fragment of
the latter, said fragment coding for an adenoviral protein selected from the group consisting of
protein L2 penton according to claim 3,
L2_pVII, L2_V, and L2_pX proteins;
114
BE2017 / 5910 (g) an adenoviral L3 region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of L3_pVI protein, L3_hexon protein according to claim 2 and L3_protease;
(h) an adenoviral E2A region;
(i) an adenoviral L4 region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of L4_100k protein, L4_33k protein and L4_VIII protein;
(j) an E3 adenoviral region, or a fragment thereof selected from the group consisting of ORF1 of E3, ORF2 of E3, ORF3 of E3, ORF4 of E3, ORF5 of E3, ORF6 of E3 , E3 ORF7, E3 ORF8, and E3 ORF9;
(k) an adenoviral L5 region, or a fragment thereof, said fragment encoding the L5_fiber fiber protein according to claim 1;
(l) an adenoviral E4 region, or a fragment thereof selected from the group consisting of ORF7 of E4, ORF6 of E4, ORF4 of E4, ORF3 of E4, ORF2 of E4, and ORF1 of E4;
(m) a 3 'adenoviral end; preferably an adenoviral 3 'terminal inverted repeat (ITR); and / or (n) a region of adenoviral RNA VAI or VAII, preferably a region of adenoviral RNA VAI or VAII of an adenovirus other than ChAd157, more preferably of Ad5.
[18]
18. Polynucleotide, vector, adenovirus, composition or cell according to claim 17, in
115
BE2017 / 5910 which the polynucleotide comprises at least one of the following:
(a) a 5 'adenoviral end, preferably an adenoviral 5' terminal inverted repeat (ITR);
(e) an adenoviral L1 region, or a fragment thereof, said fragment encoding an adenoviral protein selected from the group consisting of the protein Ll_13.6k, L1_52K and Ll_IIIa;
(f) an adenoviral L2 region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of the L2_penton protein according to claim 3, L2_pVII, L2_V, and L2_pX proteins;
(g) an L3 adenoviral region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of the L3_pVI protein, the L3_hexon hexon protein according to claim 2 and L3_protease;
(i) an adenoviral L4 region, or a fragment thereof, said fragment coding for an adenoviral protein selected from the group consisting of L4_100k protein, L4_33k protein and L4_VIII protein;
(k) an adenoviral L5 region, or a fragment thereof, said fragment encoding the L5_fiber fiber protein according to claim 1;
(m) a 3'-adenoviral end; preferably an inverted terminal 3 'adenoviral repeat sequence.
116
BE2017 / 5910
[19]
19. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 16, in which the polynucleotide comprises a region of adenoviral RNA VAI or VAII.
[20]
20. Polynucleotide, vector, adenovirus, composition or cell according to claim 19, in which the region of adenoviral RNA VAI or VAII comes from an adenovirus other than ChAd157.
[21]
21. A polynucleotide, vector, adenovirus, composition or cell according to claim 20, in which the region of RNA VAI or VAII comes from Ad5.
[22]
22. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 16, in which the polynucleotide comprises or consists of a polynucleotide which has an identity of at least its length with a reference sequence which consists essentially of SEQ ID NO: 15 or 22.
[23]
23. Polynucleotide, vector, adenovirus, composition or cell according to claim 22, in which the polynucleotide comprises or consists of a polynucleotide which has an identity of at least 99% over its entire length with the reference sequence.
[24]
24. Polynucleotide, vector, adenovirus, composition or cell according to claim 23, in which the polynucleotide comprises or consists of a polynucleotide which has an identity of at least
99.5% over its entire length with the reference sequence.
[25]
25. Polynucleotide, vector, adenovirus, composition or cell according to any one of
117
BE2017 / 5910 claims 22 to 24, wherein the polynucleotide comprises or consists of a polynucleotide which is identical over its entire length to the reference sequence.
[26]
26. Polynucleotide, vector, adenovirus, composition or cell according to claim 25, in which the reference sequence is SEQ ID NO: 15.
[27]
27. Polynucleotide, vector, adenovirus, composition or cell according to claim 25, in which the reference sequence is SEQ ID NO: 22.
[28]
28. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 16, in which the polynucleotide
includes a mutation or deletion which makes no functional at least one gene from a region genomics selected from the group consisting of E1A, E1B, E2A,
E2B, E3 and E4.
[29]
29. Polynucleotide, vector, adenovirus, composition or cell according to claim 28, in which the polynucleotide does not have at least one gene from a genomic region selected from the group consisting of EIA, E1B, E2A, E2B, E3 and / or E4.
[30]
30. Polynucleotide, vector, adenovirus, composition or cell according to either of claims 28 or 29, in which the genomic regions are E1A and / or E1B.
[31]
31. Polynucleotide, vector, adenovirus, composition or cell according to any one of claims 1 to 16, in which the polynucleotide comprises a deletion of the E1 genomic region.
118
BE2017 / 5910
[32]
32. Adenovirus according to any one of claims 4 and 8 to 31, in which the recombinant adenovirus is competent for replication.
[33]
33. Adenovirus according to any one of claims 4 and 8 to 32, in which the recombinant adenovirus is incompetent for replication.
[34]
34. Adenovirus according to any one of claims 4 and 8 to 33, in which the recombinant adenovirus comprises a nucleic acid sequence coding for a protein, in which the nucleic acid sequence is functionally linked to one or more sequences which direct expression of said protein in a host cell.
[35]
35. The adenovirus of claim 34, wherein the protein is an antigenic protein or a fragment thereof.
[36]
36. The adenovirus of claim 35, wherein the protein and a heterologous protein or a fragment thereof.
[37]
37. The adenovirus according to claim 36, wherein the protein is derived from a virus.
[38]
38. Adenovirus according to any one of claims 34 to 37, in which the one or more sequences which direct the expression of said product in a host cell include a sequence selected from one or more of the group consisting of: initiation sequences for transcription, transcription termination, promoter and enhancer.
[39]
39. The adenovirus according to claim 38, wherein the one or more sequences which direct
119
BE2017 / 5910 the expression of said product in a host cell comprises a promoter sequence.
[40]
40. The adenovirus according to claim 39, in which the promoter sequence is selected from the group consisting of an internal promoter, a native promoter, the RSV LTR promoter, the CMV promoter, the SV40 promoter, the promoter dihydrofdate reductase, the β-actin promoter, the PGK promoter, the EFla promoter and the CASI promoter.
[41]
41. Adenovirus according to claim 39, in which the promoter sequence is an amplified hCMV promoter, as proposed in SEQ ID NO: 42.
[42]
42. Adenovirus according to any one of claims 4 and 8 to 41, in which the adenovirus has a seroprevalence of less than 10% in human subjects and preferably no seroprevalence in human subjects.
[43]
43. Adenovirus according to any one of claims 4 and 8 to 42, wherein the adenovirus is capable of infecting a mammalian cell.
[44]
44. Composition according to any one of claims 5 and 8 to 43, comprising an adjuvant selected from the list consisting of: inorganic adjuvants (for example, inorganic metal salts such as aluminum phosphate or hydroxide) aluminum), organic adjuvants (e.g. saponins, such as QS21, or squalene), oil-based adjuvants (e.g. complete Freund's adjuvant and incomplete Freund's adjuvant), cytokines (e.g. IL-lß, IL-2, IL-7, IL-12, IL-18, GM-CFS, and IFN-γ) particulate adjuvants
120
BE2017 / 5910 (for example, immune stimulation complexes (ISCOMS), liposomes, or biodegradable microspheres), virosomes, bacterial adjuvants (for example, monophosphoryl lipid A, for example monophosphoryl lipid A 3-de- O-acylated (3D-MPL), or muramyl peptides), synthetic adjuvants (e.g., nonionic block copolymers, muramyl peptide analogs, or synthetic lipid A), synthetic polynucleotide adjuvants (e.g. polyarginine or polylysine) and immune stimulating oligonucleotides containing unmethylated CpG dinucleotides ("CpG").
[45]
45. Composition according to claim 44, in which the adjuvant is a 3D-MPL and / or QS21
[46]
46. Cell according to any one of claims 6 and 8 to 31, in which the cell is a host cell which expresses at least one adenoviral gene selected from the group consisting of EIA, E1B, E2A, E2B, E3, E4, Ll , L2, L3, L4 and L5.
[47]
47. The cell of claim 45, wherein the host cell is grown in suspension.
[48]
48. Polynucleotide polypeptide, vector, adenovirus, composition or cell according to any one of claims 1 to 47, for its use as a medicament.
[49]
49. Polynucleotide polypeptide, vector, adenovirus, composition or cell according to claim 48, for its use as a vaccine.
[50]
50. Use of the polynucleotide, polypeptide, vector, adenovirus, composition or cell according to one
121
BE2017 / 5910 any of claims 1 to 47 for the treatment or prophylaxis of a disease.
[51]
51. A method of inducing an immune response in a subject, comprising administering the polynucleotide, polypeptide, vector, adenovirus, composition or cell according to any one of claims 1 to 47 about.
[52]
52. Isolated polynucleotide comprising or consisting of a sequence according to SEQ ID NO: 2.
[53]
53. Recombinant adenoviral vector according to any one of claims 4 and 8 to 43, coding for a transgene for administration to a subject which has been previously exposed to a recombinant adenoviral vector which does not comprise a ChAd157 fiber, or functional derivative thereof, as described in this document.
[54]
54. Recombinant adenoviral vector according to claim 53, in which the subject has been previously exposed to a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55.
[55]
55. Recombinant adenoviral vector according to claim 54, in which the subject has been previously exposed to a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55.
[56]
56. Recombinant adenoviral vector according to claim 54 or 55, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for a transgene intended for a medical indication or indications different from the recombinant adenoviral vector according to l any of claims 4 and 8 to 43 encoding a transgene.
122
BE2017 / 5910
[57]
57. Recombinant adenoviral vector according to claim 54 or 55, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for a transgene intended for the same or the same medical indications as the recombinant adenoviral vector according to any of claims 4 and 8 to 43 encoding a transgene.
[58]
58. Recombinant adenoviral vector according to claim 54 or 55, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for the same transgene as the recombinant adenoviral vector according to any one of claims 4 and 8 to 43 coding for a transgene.
[59]
59. Recombinant adenoviral vector according to any one of claims 53 to 58, in which the transgenes code for an immunogen which is useful for immunizing a human being or a non-human animal against a pathogen such as bacteria, fungi, microorganisms parasitic or multicellular parasites that infect human and non-human vertebrates, or against a cancer cell or tumor cell.
[60]
60. Recombinant adenoviral vector according to any one of claims 4 and 8 to 43, coding for a transgene for administration to a subject which can then be exposed to a recombinant adenoviral vector which does not comprise a ChAd157 fiber, or the functional derivative thereof, as described in this document.
[61]
61. The recombinant adenoviral vector according to claim 60, wherein the subject can then be
123
BE2017 / 5910 exposed to a recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55.
[62]
62. The recombinant adenoviral vector according to claim 61, wherein the subject can then be exposed to a recombinant adenoviral vector comprising a fiber, a hexon and a penton of ChAdl55.
[63]
63. Recombinant adenoviral vector according to claim 61 or 62, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for a transgene intended for a medical indication or indications different from the recombinant adenoviral vector according to l any of claims 4 and 8 to 43 encoding a transgene.
[64]
64. Recombinant adenoviral vector according to claim 61 or 62, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for a transgene intended for the same indication or for the same medical indications as the recombinant adenoviral vector according to any one of claims 4 and 8 to 43 coding for a transgene.
[65]
65. Recombinant adenoviral vector according to claim 61 or 62, in which the recombinant adenoviral vector comprising a fiber, a hexon and / or a penton of ChAdl55 codes for the same transgene as the recombinant adenoviral vector according to any one of claims 4 and 8 to 43 coding for a transgene.
[66]
66. The recombinant adenoviral vector according to any one of claims 60 to 65, wherein the transgenes code for an immunogen which is useful for immunizing a human or non-human animal against a pathogen such as bacteria, fungi,
124
BE2017 / 5910 parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or against a cancer cell or a tumor cell.
[67]
67. A method intended to elicit an immune response in a subject, said method comprising:
(a) the administration to the subject of a recombinant adenoviral vector according to any one of claims 4 and 8 to 43 coding for a first transgene; and (b) administering to the subject a recombinant adenoviral vector which does not comprise a fiber of ChAd157, the vector coding for a second transgene;
wherein steps (a) and (b) can be undertaken in either order and the first and second transgenes can be the same or different.
[68]
68. A method of prophylaxis or treatment of a subject, said method comprising:
(a) the administration to the subject of a recombinant adenoviral vector according to any one of claims 4 and 8 to 43 coding for a first transgene coding for an immunogen which is useful for immunizing a human being or a non-human animal against a pathogen such as bacteria, fungi, parasitic microorganisms or multicellular parasites that infect human and non-human vertebrates, or against a cancer cell or a tumor cell; and (b) administering to the subject a recombinant adenoviral vector which does not comprise a fiber of ChAd157, or a functional derivative thereof as
125
BE2017 / 5910 described in this document, the vector encoding a second transgene encoding an immunogen which is useful for immunizing a human or non-human animal against a pathogen such as bacteria, fungi, parasitic microorganisms or parasites multicellular cells that infect human and non-human vertebrates, or against a cancer cell or tumor cell;
in which steps (a) and (b) can be undertaken in either order.
[69]
69. Recombinant adenoviral vector or method according to any one of claims 53 to 68, in which the recombinant adenoviral vector which does not comprise a ChAd157 fiber, or a functional derivative thereof as described in this document, presents a low cross-reactivity with the recombinant adenoviral vector according to any one of claims 4 or 8 to 43.
[70]
70. The recombinant adenoviral vector or method according to claim 69, wherein immunization with a first vector elicits a neutralization titer which is on average less than 50% of the level caused by immunization with the second vector.
[71]
71. Recombinant adenoviral vector or method according to any one of claims 53 to 70, in which the recombinant adenoviral vector which does not comprise ChAdl57 fiber does not comprise ChAdl57 fiber, ChAdl57 hexon or ChAdl57 fiber or functional derivatives thereof having at least 98% identity with it.
126
BE2017 / 5910
O ο O o o o o o o Ό o o cogold.· co co 07 CO co i’o CO œ co
O ko ta
G
Ο G ta
o O O O £ 5 k0 your> your) your your your your:
O 0
<0 - +1ι P P G p ta G ta · ta 0 your P G ta P GInP GH ta G tat P G ta ta G^ 4P where ΕίS-4 <ΆE'1 7 ~ t 4-11 at S-E rts El Ω gP P Hyour your P your atΩ H"Ω(( g your your your> your your >;> > .- z your your U 53i K Ö Ω your w ft g gi 0 0 0 é> 0 2 G S 0 0 0 O1 " © © G © 0 19 yest -.14 f-S P < 05 " P P P P P P pS fii H K Μ your Μ your Μ Μ1 O Q P at Q P your Q 0 your O Q! W Ω ω G Μ G ΓΛ Μ1 your P P Ö Q your P Q Q your Ω Ωi > > > L> fe > > 1 /1 P P your not P your your P P yourΩ O 1 ÎH Eh El yourP ο ί G G G ω GG G G G W "J P r > 4 b ~ 4 Ω Pb-4 your Ωyour ί p your your Ω P your your P P P ι-Ί Ω your 4-Ω had your Yes your your Ω0 i 0 e 0 0 0 0 0 0 O he O e O 0 © 0 0 qi G 0’3 your ω G 07 G G G G Ki feir " K vs* your Μ ÎP your w1 i> U 0 0 Ω 0 0 0 0 $your 0 0 O1 H El El your H P p Eh1! g SIta g S g at ΪΓ ’at your your V 'S §I1 <A Ω 5 PP <he Don't P h-! s! your your your H P your your'3 P f-1 H1 Eh El Ω your EhP Ehft P p P P P P P P AT if1 > -l Ω Ω p , -1 Hl P H ο your S your>g U ftp update your 1 at g0 > .. 1S tl iC-f p xb t1 $ your your K laughed g your P &rs 0 0 0 δ 0 0 0 0 0 Q 0 e-H 4 · 01 Q Q your i-1 P 0 £ -1t Could P your G youryour Ή PO your K your1: f * VS" Yes this P * ex ex 0 07 01 0 0 G G: 0 G G oj Kî 01 ft >ft h v> ft £j P your P yourft H your ft ft And your4: H El your your H P P1 Sy ta > > > > > :> E> b- > > >J: 1-4 ►4 your P , -l your l— ‘ your! P your your your your your your P P PP/]: Οι had This This Ch This your youri ^:your Ö4 Yes 01 ta your 04 r "; your your 04 Pi your P if P P < P P P1 your G your your your W your ixf your your Μ ex w " your g yourï <yourG s P P ft ft Pl3 P ω 0 OG <Λ 0 Gj oi G G G ο 1B your your your your P: P AT ftTHIS yourex O 0 Ω ' P * Q£ 0 Μ- g. ft your your your your your 23 & g  · Ρ s your 4-S your δ £ S Xi yourΙ P your your P: your your P P ru your H your your P P P1 G G G G G G G 0 G G G G -2 P your P your your {..I yourr H ft8 your P L ^qB your P p ►u your your G 0 G G G G G G1 > > 0 ί> > > your> > your Eh • --i E-1 your H £ * · < P10: 0 0 0 F ·; 0 0 • fS Φ · O 0 0 G 00J é 04 your your your 0 < your (AT; your your your your P Pi P P P P P P ft your Ô4 your 0; your O4 your O: your O4 your your >> ft S- ft >1 G 0 '-0 G G G G G G G G G OP § P P P P P P ο 1 P 10 ft: P your your P Îp your your your your yourp g P your your your your χ; ' your ex o o at exO Where ex ex 0 at: <-4 -H your Had your This 0 your ûj yourΊ h-! 01 your your your your your your your your your your P H ft ft P P P : ft /1 0 0 0 0 0 G 0 0 0 G 0 O:> P q P ft P ft ft ft1 This This Q O P O Q O your Cl O O1; P fl P ft P ft S ft ft1 0-î 01 your your- your 04 your your your Had 0) your1 P ft> P P p ft1 Gft G G co GG G G G 0 01 ftyour ’> ft your ft • Μ1 ft ft ft > >î> r * ft > >i : - f your your your ÎH Ph-d Eh1 youryour your READ your your your you your your yourj P your your; P 14 " your your1 your 01 your! This your O4 your your your 04 Bone VS; O t P P G P P P P P Ο ! # 4 04 your 0; O4 O4 0: your your your This your your ί 0 G 0 G G 0 G VS) 0 your £ 4 H P p ft £ h Eh LH LH & H Eh your <-4 4 G G G G G Ώ G G! P your your your youryour P P P your yourj F H Γ> ^::: 4/1 // Eh your • -i Eh Eh! This you your your your your your Ui your your your your; G 0 G G G G G G1 Your 01 your your your P your your P your your Thisi ΚΙ- * > > ft t £> · ft ft! > > ft ft Kj, tr > > > your· K_ f > >i your p your your your P P Don't Don't! G 0 07 G G G G G G G G G/! P: 1-1 > H yourI 04 04 state your O4 04 your Cf O4 O4 your Thisi 01 your This your Cl your p This your 04 04 your your OR your your your your your your youri G L0O P :: / 0: // P G P 0 0 0 0 2 0 0 0 0 0 0 not O ! G G G G G 0 01 G Ο// G // G ..... your G ·: ·· ^ ι: · .Ά <G> - § G G g your O i your your your H your îH ΈΗ Eh CM your ita your your your your your your your your fri your <•• 4 4-ta :: < your your ft your your P p · your your H £ h your your P H P Pi P k-5 P d-4 your your your Ώ ta: your Q at 0 your What at Cl P P! G G G G G G G G î » > 1 your p your > 4 your > î > H your youri P your your P your your your i-Ί Yes 01: your your 04 01 your This p4 O4 your Thisί t — r 23 ë55 25 your 23 £ > 4: your p your > 4 your your TH P your yourί JH ru your your P UK Eh Eh! > ' ft ft k-xyour > > i> r * > > ! Μ your• U B your your your; B 0) your This 04 0i your your your 0i25 your Thisί ΓΗ ►U your your P £ 4 Eh Eh1 (¢ 4 23 your your 25f ^a ta £ g & PI Μ your K your ftA4 your your K Φ your 10 01 your your your ! - ‘U your your your your your O i your your bd ta: your your yourG G your G G G G G G G fri your P -l · your your Ω P your your: your Ω your your your your your your your your your your your youri your your & vs Ct your This Ωt P at at o your your your G your your P 0{ your your Ω This your your your Ω1 G G G G G G G 0 G G G 0i ..... G G ê- l · ''. · p: H p: 0 Eh your your your H H your your Eh Ehyouri P P •your': >: p: - p p^{:> EH::} 1 your your your your your your your your your your KP i your your El ..... G P P P El{ Don't P-.your Eh H your your Eh & H PI Eh your Ei your P P P Eh1 your your your your your your your your your S Μ g! ..... H -your:// E'i • H ...... ft uoph < i>ig g your your g your μί your your This PQ Qiyour§ § fe 2! 'S * ex O Where ‘ O 0 5 ex O * r *IQLO: 00 Γ · 0UQ Ή 0 P ^:r-t CM Uh O σ>ΙΠ iH < your 0 TJyour C <1 w W CM <0 TJ TJ P your in H your. cH <u<-HT T < p TJ T5ÖTJ TJ P • ü TJ P 'S 'S TJ Ό τί s at | fi"J P ►c P ft P .P.1 SAx P ft g δ PCM P Cl i vsώA4 P JdP42 C>. at" your, 0, your. 0 _; . υ]^υ ι your 1 your1 G Q H o. H 0 o. 0, ©> your'₍ l cm ' g ' * φ · LO ‘ co' your ata 1 G 1 Ci 1P <M 1 Cl G Mb t> · ' LO ' p ’ ίΖ your oo G Ö O 0 0 your P rH your 0 O O O O · G VS·
127
BE2017 / 5910
O ko t-4 oLf> e4
AT <3 < E '! AT AT i_G AT & .übi LD ωO Û3 her fê Μ CO σι CO Κι ► ·· > > > H £ -t AT Ht ATAT fti at ft; Ri w 0 <D O > £ < ia O 0i fcj +! H AT <<1 <1 4 — thi AT £ -t CD O <-l hi > -4 AT & & & biYes S Q Q Q α O O O " > > BAT AT t-ïAT AT O-i ft < cu Cl; < f4 "! * 4 " 13 ·· O * Of 0Ί ö> K> ’73 ά o o 0i § teri Ä »Î-.I § g t. 1 b4F-Ι have <0 CO w :: · ’e < CD O 0 e g rf! rtl $! 2>
<nl Û4
<FÎ td S rtj ! aQ κη :> > > »--F AT H Ht t — 4 AT or FC,W 07 CD '3 0 <P Yes • 5 W have F H 1 i Ô1m have > > > £> £ f e-: AT H H +AT h3 f-u ft; Ri at, its)V3 w have £ H H AT VS- £ 3 & Q> Where AT Ht YesW shoutAT Ht & & iz, jh £ hAT P &Μ £ h Eh AT H &AT & & " & < p3 hî AT Ht ft; had ftt 1¾ ft; CD ftt -Œ ÇQ at: El> > H H AT ÊH E-f H AT £ h H H > > Ω Ω Q Π Yes at Qt at O -r — i t — 1 ïS <M CD xi -d T> <Ü s"3 <3 <cC"3 O, ü] m. fti t 02 ’ > I. Ö j Ow
I
128
BE2017 / 5910
O OO o o o Ό o o 07 07 O o <I < o O o o o o O p ί · Ίp p P P P p 070-1 O1 P 04 ο · ι oi 04 04 £} 04 P Ol P <· - ..) 01 O | Ol where O · OI <P fO 07 07 07 f 7 O) 07 07 f * T 07
Ó O p > P > C4 -T- 8>^: k> rt > P> ·>>>P > È> tn t ^:<5Ε0 < P .......^; <: PN ·: 'pH B > i ..... " P & δ P P P " P P 0 p 0 0 M 0 P Μ1 ζ-i your P AndÇ4 £ 4 In μ £ 4 Eh E4• 8-ν 0 0 0 0 : -1 0 0 0 0 q * o Q Q α o O O at at O Q ip P P" P PP1ft 2 b-J »O AT P P μι P P Pi & P ^:7p < P P your P p; k P1r41¾* 2 ' < P<2 2 2; Εη P P P: PP "U P p:iher : l: 1Z £ 3 is • << EÔ < n> Eh'N ........ £ 4 ..... P :. · 2 ·; : ϊζ P is iz ) Z " 8c X-J 0 0 l ^:. · PS · * " " : ^ l0 ........ 0 > · 0 <· 50 <l · ^:& φ << P " 0 0 0 0i O i o p > 1 ...... li * 2- ty ·, fhS. ^:P * P vZ 0 ί: Ν> Εη7 ....... CO i <: E2: : <iP < > fe CO CO CO P 07 t '' ï> > H H P P < yh · Μ c4 7 Εη : P P P Pi H P P P P thisyour p Î4 • f2Eh e ' e μι In Eh 07 0: ........ 5.P '.^: / P7 7p: N; NiiETi : <»: : ..... Eu iiWo : ^; : Ε · Ρ iuft• P μιH: P P »Μ ‘4 PE i ΤΕη7 P · : · <Ρ <· i'-P-ii^{ii:: P'i:}'0 70i: £ 05 505 i50i © © you o 0 0 0 0 © © you 01 7 Ε * 5 : 800£ m 7P7 : 0. • p^::: <Pii i i iipNN 7P7 " " ” "$ 2 o ©; c < gold -0 *L ΗΛ P 0 0 8-4 0 · 0 0 0 0 o © o 0 0 0 © © © 0} 0 00 0 © 0 0 Ï7 0 £ H your {H £ H H E4 P e e e & H1 Ρ P P P s 0 P P P P >g % "-V,VS, g l ^ -s.!> > * ·,i> > ^: î> £ £ 5- >ί1 & Ο £ 50 > s0 ÏZ O iz. at S3k 0k 0£ 4 0> 1. 0NoP < o ί e your &H Eh Eh £ ~ i p h Eh O 1 k £ 5 is vZ <z 8.'x §. 0 04 4 i he " Hf Cl > -l μι P P .μ P " P 0 1 0 0 0 0 0 i-4 ..;>. 8> :: '8s>: Ol £ .- < · <" < : ” ....... > 2 ' g 7 * 2- ”laughed 5: 2 < 07 -h Ω P Q AT Ω Q 0 Ω Ω 01 ..... tal · : ” • 0 Ή ” 'A' ^ ii · 'laughed IS " éï 0 0 0 1--4 0 0 0 0 , V , ·>i ftl μΐ 0 x4μι P P β- P © P1 & is ! S iz <z iS 0 0 0 §j " Vi CO ω m " CO 0 ω CP : & r pί Ήk P B-3 4qi p PPl 1►> f Ω Q g P P Q P Q Ω Qf ^:Q S :. .iS ': at : Q O 2 2 2 2ί Γ : i-s, *>i> • fc s,k - ** ê iP ï> %i '· &{ ^:........£ ΐ ...... is ......1 PK ......! H xoI CO: i58 / 2oi0 i "ίί: p -ν '..... CM"Ή Ή P k k1 · 'H 50 ^:k t> fe > O 1 0 0 > 4 > 4 ι · 7 P 84 84 P 0 P 0 O t> 4 kk P your 5P : k VS-! ί Gn 0 & Cl · Yes p p P P P P P σ> f 0 0 0 0 μ! 0 μτ Yes 0 0 e- ·] 4- < 3 .....THIS D K ' : ·: ^: -P bf2:> <> ^ NN <P < 2 P 0 Ρ P P Û40 " your P P1 Q zry 0'0 0 0 P 0 0ί 0 0 0 0 you 0 © © ex<2frj 8-4 P H .Èf: hM. : 84 H • <isô P ..... pH Hr cP 0 at< O 0:O1 0 ' 50 .....7 ^: & N < ·: Ρ · '> & ·· -ÎSH ςζ ΪΏ r 0 0 0 δ <5 0 © 0 > 01 < 8-4 <: · Ρ ^: ό ί * Ί Ή : · Ρ4>: ............ ip ··: ....... ÎpA 504 707: <: 0N 7 0 0 0 0 μι 0 <μ h4 S 0 ζό rrj 0 .o '0 VS* 0 0 0 021 0 P P P Cost P P ip P1 0 0 CJ ►4 ^:P P P P 0 0t 0 0 0 0 μ 0 O! 0 0 i-41 M & S £ 4 Μ p S k k k kt 0 CO 0d CO rn co m CG îïï CO o 1 O O 0 svs:·o 0 0 0 0 0 1 0 0è 0 0 μι 0 <μ 0 84 d G 1 jz ': ...... o ..... ........ • Q · P: Yesis p£ 4 CO 1k is " 0 0 0 0 0 04 - ♦ -: .x -at'·........ > W < <w < •, ’P '· LH H: not E4. E * i P 0 * 4 k is is " 0 0 hx 0 01 P p Ei Êb £ 4 L “> £ 4 P Eh & H1& at Q Q Q ’ 9 VS Q Q ^: 1 P >>. >! > -1 > i L » Î> i H > H1 2 2 2 2 μ 2 2 2 2 2J> > ' Λ '  USK IF : s:Ή ..... : · H ' 84 P H H1 Q 0 Q 0 Q Q Q Q Q Q1 THIS 0 & Cu ίΧ | 's P P P 0 01 0 0 P & y your 0 P ÎX4 P 01 < This '0* E " 'P < • i £12 < > 2 < 2t Ρ P P-d 0 your 0 P 0 P P1 i 0 & · 4ώ i3N Pat w ^:Where Q £ : ζ>; > π > 4 > 4 >> j > 4 P P P s £ g s sS i> ” s; _; 2 2 2 2 " 2 2 ÿ 2:> 2 O£ 7 Ω d O p CP at oh O 0 at y;> > > > Ö £ >k CDi® ·· i7PTo <* where > 4 D-H 84 H H Pμ & μ • k at 0 & 0 ëî 0 0 . — 1 4 ' ^:o · * q 0 0 ; ^: o 0 0 0 0 0 ¢ 4 4 Ρ 0 0 0 .-1 8-1 0 84 1-4 i-41 i4 0 »4 > 4 p : -4 P > 4 84 0 01 8'4 84 H 1- ( 8-4 8'4 84 Eh E4j ω CO ’Y) wCO CO 0 CO CG 0 0 Ρ ^:0 0 0 μι 0 0 > 4 i-4 0i: This o© Ö CJ • o , ’Iv 0 0 0 READ σ CM O < Where O P • O O)li: • _: -ra <0 ito This CO CO g è£s; 0 c ^r>0 g b 0 0 0 O 0li co co Î0 co co' COCO co CG 0 0 k 0 3§ § * · .. * f-C 1 < K. 5 <g ^; i ig > hz K ·: >> r:: > · £ </ p N £ -P Eh æ. < 2 2 H 2li;CO CO you- COCG CO 0 0 0 £}: k 0 Ω 0 P not Q 0 O 1 3'4 M M M 84 H^{: <} p : : py P : '<p6 · <0 < ..... 0: 0 î ΕΗ 8-1 84 d-1 • —I El > k >, > P 03 ί 0 Cu £ b CL 'P P P P P NP P P 0 ! Ρ 0 P 0 p P P P S ; -4 • Ê 0 COULD & £ L P P P-; P P P p .: P P 4 * kj-i X gSJ^ 41 p E-l F H H e- ’ & 4 Eh Eh S4 P ’’ O-l In! fiv 0 ’0 0 0 0 0 0^r 0 (71 2 2 H CO <2 <2 < 2 2 e * <! 0 0 0 0 © 0 0r.O 01 co CO 0 00 co CO ’> 3 0 CO CG 0 0i 2 2 2 22 7’S 2 2 2 2 21 > > > > K.P * << ί- > < Eh P: ;> > >1 d 2 2 2 2 2 2 21 P E-f E- » Eh Γ: - ' r-f H In £ 4 £ 4 £ h EJi ft. P P 0 0 P P P P pÎ 0P 0 h4 s4 14 84 i-4 P 84 > 4 P;i 0 0 > .3 0 0 1-4 0 0 P 1-3! ΓΗ Éi E · " S4 Γτ-ί Eh In £ 4 £ 4 £ h Inj Q 0 P O CM 0 w p ίώ w O Î CO CO W C-0 CO CO VS) CT CG 0 0 0 0 j l ~ " 0 0 0 0 0 0 0 0 0 0 4- CO CO CO co CO" CO CG 0 0 0 0 j JZ ‘.V §21 £ 0 0 ’X ', 0 p 0 0 Q Q P not Q Ω at P 0 0 P 0 0 0 0 0 0 0 0 3 S! 2 22 f2 > 2 atbsj < * 2 2 21 0 0 0 co co <0 CO <0 0 CO! d<ç < 2 £ί E4 P ' 0 P fUj. Eh P CG P P P £ 4£ 4£ 4 Eh E-i£ 4 ί 0 Q 0 0 Ô Q Q 0 0 0! 0 0 b4 > 4p P μι P 0 P 84ί > H P > < P P P P P P P: &2 0 & Or P P P ftl P P P ί 0 0 0 0 AT 0 0 . ./& < 0 0 2 > < < < < * 4 p <* 2 2 P1 b4 P 0 0 008--1 0! co co V3 07 CO CO w 0 CG 0 0 0ί 2 2 2 2 2 2 2 20 P8-n 2 P p H friÊ4 Eh E4£ 4 Eh Ehί 0 0 0 0 0 0 LO W Oi: O CM Q o O Yes Where at Yes o < O Oί Eh P 2 P P P CO CO CO w r-IQ 0.toP07 r · - chLO rH Ö r-4 7-8 01 Ù707 p 0 "Φ Uo P 0 P CD Ti< <7w e4 ol P F H PE 07 TJ 0 P P 0 > - |T5 : this <-4 PT5at THIS 07 g> p2Λ1 $Ov 77at TJI TS<.P Ήat Her Ό<P 2 82 C.2 ί2 Όat 20 2s TS20 0 0 472 TJ234 5 o O°! T T ° l T° _}P1 P j notί 01 Ps T 0 ₍0. 0, t QE T CO 1 p > -4 ^:1<'4 1 07 1 1LO <0 f- • Ö3 σ> 10 1 î-H t £ 4 P C4 1071U7 ED ’ 1P t CO vs. ÏC O O Where o O o <0 <0^: O 0 rH P 0 O O O O Ö 0 O Ö
129
BE2017 / 5910 σν rd CO σί rd
CO
^s > > Ή i-P r3 & ÊH Pd ï * 7 ^ g * s 0 C.Q w Eh ’/ ' fed fU h! AT > 4 J> d 1-d ö δ 0(X h! w 'T AT This Q h!ï > & δ < Cü ω £ £ » F> - W h rd -Ί or- & Pd £ e α Q * £ · ό u n | δ Pm Ht ηΊ GQ GQ H ï - t & $ 3 $ 2 ö vs* * 3 f3 Q Ω fire P-t Could > 1 > 4
UH r-ΊΜ f4 < d-4 Ο S Ο £ d fe & χΒ £ 1 U .-v ’ Η ƒ · / i-d & <Λ <O ω Ö ο ö Q d α d : vÙ ~ 3 α Ο Η Η "I & <5 > η
r-ί f "&
Pd o
<N "
"
Pd i rd
130
ΒΕ2017 / 5910
XT ¹ r; O ç> p you at. <71 VS··.· If ¹ O O O O 'you knockout you you you you summer O O you m C7i Knockout"T -P CO w 03 CO p030 shout * sf ^:KV * 403 03xl · "T xr"ΣΗ
you
CO
'P i! " P > 5y £ fei P35. P P g P& S•youtP tee3 0/you- 0 <s 0 / £ 4; g -té: P g 0 tee r "you Takes away tee teeI p P p he P P P P P: P »5 P1 & ώ P youyou P you youI F-! P E'i fa E'i θ '» P Eh E'I you ga youl ·_::: 0:> </ 0 / youP 'you' p > < £S / •; p /I I p& P 1Pyou P tÖ p& P& PK P t1}g ► ··. · ”&lî * § 'you g4ziS * fÿ » &I you not P Q P Q p P Q Q Q Q you >! you > < you P P P youi & This Q P P O P 8 P Q P P1 Q ' σ youQi Q at O at ex O 4 .0 vs 0 P Q / Pi 0 5: W: ïfe * s * you 0 1 0 &. tee tee you ie you you you. you you σ> 1 P p / £ 4 < / £ 4you y: S U you P ' i P P P " P P you at P; (Y) 4- JS i 4 P æ K £ ·> B you you P P p P P₍ -l P b-Ί t — 1 P youj OP P Ö 0 0 0 <5 0 0 01 0 0 0 Μ " 0 0 43 Ö3 0 > > > *> ’> > > > > > >1 03 0 0 0 " 0 0 * 0 03 03 fa p £ 4 R <0 0 P P E-l P 0: you1 £ SSyou " 23 23you ’V f · -. -fa. 'p H:: ipl · ^:: P / w HH H P Μ Μ / 0 / Summer s" f 0 / '0 -07 ; 0 rfj . <4 you you <! you< S & S:^:: A ' : / p; 7 AT γ- xp; ç> 0 0 P Φ 0 0 0 G 0 0 0 g- £ to-1 gP H AT Α p / E ^-1P P K E-i P g> · < P E-i ; Pyou; ^::> E><> > r * at' ;> oS t "~!ÿs' ω 0 you K you > · 00 0 C! 3 O 0 0 b 0 0 Or ; Ω P you- Q Q P P P P P P you KS>æ you Qis: ! S S3 £ 4 you S p 4- lia fire you P you you: you P lia lx < you :you you P 0i oh Ö ö • O you you _-P:: P your 0 p 040 0 0 m 0 0'1 0! P Q Q P P Q P you you you; fap P > > P P 1-1 P P P P & u I you fa you you you you you 0 r’j 0 PJ 0 P 0 41 0 0 0 0 îX 0 S fa you you you you you fa P E · ' This i'm Ρ Eh you E-i r ~ < Eh you P P: P P AT P P AT p P O 0 0 P 0 0 Ù3 0: Φ 0 0 0 Eï4 0 you you fa you ·> H six i> * fa: P P P f P P P P p P P HH P IP w P Μ 4'4 A3 ! · summer x; & you you you/ Xiyou you g you you P O Q Ç> O o ί : î p <1 H P you youyou .you Eh : O> > / ¼. ·. ·>. · > AT AT < · < r- { H P H H P 1! 1-4 you ; ·· < P Eh 4-4 LO 0 0 CO have 0 0 03 0 0 04 4- > > 1! t> > >. H you r * H you : P H you P/ ^ / 0 you 0 0 P Eh P P{ &< VSyou S..03 .. you < you 4you > > > > > > > > P >1 »K 0 0 P 0 0 you 'you you you E4you Eh Eh Eh P ElP{ Yes > -.- ·. & JS <: ·0 i 0 0 you5 ** · § 0 0 0 0 VS!) 0 0 0 0 01P // << B .. "·. · ;. . p: 0 0 0 0 0 you ..... H •you <tee /: 7p7 <; p /; • P 0 & 3 Cfi 01 p Q & P P Q P P P Ω P P you 4P • ^ P P H Μ El P Ht £ P > H > 4 p P you you you you you :you 0 / 0: ' 0 /; 0 << 0 / 0 you you :you 7th>1 o Q P P P O P you. , · -> Ω <'ù4 < you rtj ' 0 you you fi at; O ί [—4 P P P .J; P P P P P you! P OAT P P P P P P p P P you 1 0 (0 e 0 0 0 0 0 0 0 0 0 you ; - <S ; is 22 you -you- ; .- <S ·· 0 0 <0 / < ; 0 03 4- to 0 0 P 0 tif 7p P ' 7P /: P Ip7 P you P 0 0 0 O 0 0 0 0 0 01 0 0 you <Q 0 0 0 CP 0 0 0 0• 0 0 0 ' / Pi- 0 707 you <head . you / t1 P P H : h H Μ •: p:: 'P ή: P P7 Pt; > ^ 4you £> î> > > > K> p & you you you Μ you Syou youl · '. · < f , &. -you you at 0 0 0 ;. Kl:f <// »/ 7; 7 '· | 7 · ///) /// • / Tl · ........... .....! · : Y <: 0 / tee < ip7 <tee <·· you P P P P p P 1 :: fali............ /// 17 / 1. 1 ........... . " you '.you: Μ Ql · ; <i; /AT- you ’S > ; >>; - i i 7 / Î77 1. 7 '(": 4 //! </P <P :: P -P- · <P:: '07 40 :you / go; 4 <0 / ••co • 0 ·: "1ί ........... ............ ............ // <i77 ...........: fe <: 7p you vs. f4 7P: P * ς> > P î-> > P P P !> O i ........... ...... 4 ...........: I /) // ..... ..... / 4 // the _:you & · you 7¾ <you 23 O l · 0 0 00 0 0 VJ 0 your • 0>...... l xj / x ..................1; ” P P you you you iatyou you <2> <’S 07 4 ...... l · /77 _D7:: ........... <:] :: < at P Q P P: ÖP P l · - · .PAT > :: £ _SK ............................ .....Vi 0 0 0 0 i 01 you PI H <; P; / H K ·>............/·{.:/e. ·· .0 / 0 0 ..0 0l · 0 vs* at Where VS# Where at at Yes O t .1: ra 0 0 & ’30Γ 0 0 0 0 / 0 0 0 0 w " // <l ·; /// (x-4 //: © <: 0 P P .0 0 0 0 • ’ 0 0 0 0 0 ® e /he·//// · //> 4 · / : /) //w: P <: tee '<: p you -you· <3 Ό 4) □ 4> O Ό D 0 0 .........<7: 7: 7 / 7 (// ...... ......CÜ. you at 0 < at you you tee ^:you you you you fa fa; /; /! / ;;7 / (7- t .. ............ifcâi P s-l P P · P youyou • P F * ’ R-l JA] P E-i E-l O/ 4 //: 7: | ^{:: <} : : ......... ...... ......<5 0 0 0 0 0.^: O { p P P AT P Ptl l · - ’P/ II · //// (/// 7 <f7> i ........:: θ < P P P p / P you 1> i> > > »4 ' > 4> > 03 4- ..... ^: l-7 / -4-- / 7 (// <<< ’<<< / 4/70 0. 0 / 0 / .0 0. < you P P h1 t-4 P P P P; P > 1 fa PE; / 7 / (7 i 7 7: <: 7: <| 7 < .......... : <<> <<  Fx. .you- you you IS you you you : P P P P P E-i fa ..... ...... ........ 7 <: d: <7 <<: (<<: -4/7 : <-! << iis ·· ' IS here you you p you [xt you you you you you fa wire ..... Hi iil · / /// (/// / 7 (7 / <: 4 <7: <:: ·: << H: / "/ / Pi H <p / tee: you you you4 you you you you fa fa 44 / /// t // x4- / I4 << /// J .......^: 7-î < ^:you^: -ty < you you 7f ^ < 0 0Ό 0 <d gç < "; - / - (// 77 (<> / ........... '<':! <<< H 7p7 / 44 you H H R P you P P P P you O Q : <<; 7 · · //:) / 7 74 </ </ ί / 7 7 <Ù ^: 7 •you 'you' you· you & P tee P you you you you you tee tee fa fa x / d / x  ! / 17 < <<< l: 7: <  :;. · :. P P P you P you P you P P P you fa W O ^:: 74.: / // 7 (7 // 'P / ·<<; <: <: P P P p. 70 / · 0 O0 CO • û ^-5 1 l4- < 0 0 0 0 0 your your 07 / ^:: À77 Ί ....... ^: <4 < ^: < P P iP <: P ' <P7 0 youP you you p you  ·;> H. P fa fa 07 4-i <// ;: <'/ 747:: <4i: you • tee ^;/you- you'·· you > P you P you you H w w HH w P H w x / l · / </: _S <<< ..... ί: 7/4/7 H • P • P <tee < ity · you p tó you you you you you you fa fa AP ' : ( / 7) <o....... -P / P • bH · 7p7 <p / / p / 0 0 O p 0 O 0 r y υ U /AT/· // 7f // < ...... ί.<:: l · /: <0 / 0 / <07 0 0 · 0 24 JZ you yous you Ss fa /he·/ ....... ..... ί............ ity'^ 7 tee tee Μ•Have Μ 0 you you you you P you you fa fa ..... 4 · : <): <: ί .............. tee; s / tei P 0 0 0 0 0 0 0 your your ..... I: · ' 4 ..... ................. <P: · P you •you you you1 0 you you you you P you you fa m ..... i : <ί: 7 ........ //! <<: < .......P / & 'you· you you Q you you P P P Q Q Q at /// (/// ....... 7 ..... ...... ....... :: ....... you-tei •: pi. 4P p.l · 0 you you you you you you you fa fa ..... 4 J ...... ........ : <': (<X < J ...... IS • 23 ïèi you tee <<< tee < you: you :you' P P P P ; p: fa fa Pin _r .133p07 F '; ûy0> Pi -P •you <~ 3 <4 lOPyouΛ P: 0 P Ö p Pi43 p P r-l <4 xH r-4 P 0Ί • y TJ you c0 p c-4 e-H C4 P P fa <n Ό AT''* OΌ 45 > 0 you η Ή TJ g AT Ax laughed A>Λς you you you § " vs A <f- » youfi ' fi p "1 H P P .P . £ 1 r! 4 <0 <d you at A4 HaveP Have fa .P fa 0, ° l^p i Ήi 0. 0, 0dÖ1 0, ^ 1 rx 0 _{0, ί youi O, 4 O. Q. 4^ü i Q g » ÎX; f cH 1£ -) 1 CG y P k0 1 f '* ’ 1 CO σ- <' D 0 you CH1 Cl 0 'p ^:ko ^!0 : Û4 <0 ÎX <—1 O you Ο O 0 0 0 0 O r — 1 you you O 0 O you 0 0 O O 0
131
BE2017 / 5910 σι σι
η 0 g αί (Μ d * '£ 4) i * > 4 > 4 Ο Οί ίΧ ”. Î44 £ 3 P > -Ί P ΛΓ> 03 h 03 * £ CG 03 P y > !> b (at) p * ....... P P fcj p P pir L < l-b <H H Q ' ex < < CG ω Es E-i > K ", P * ^v £ - · < And W fâ CG 03 P j — i & & < P P ; îg:> 03 O OSY £ ÎTf 03 .03 P P > > CG 03 > G · ' CG 03 S : 1 > H-1> O 01 03 ω O CJ <> & 4 îxt Hl he P U > > ) -4 P. R H P P & îtf < FÏÎ Q P • * 4 & : ÎX3 ’ cg 03 £ * Ή Hi ÛH> P U Q S JS Ö4 P CG 03 □ 4 p ΓΎ f-v k-Μ δ; p £ h
132
BE2017 / 5910
Where χό
C-l KF: <ty your ö‘- your 03 aj o. · <ri your F-! your your your TO <x> œ œ C'.J<•• 4 "NOT your t-1 tO lgIta to IGKp kt KP Ki ’r- Γ- G- r- your your Ù7. tGif) U7 LG "> ίί) IG LG IG your iQ : U‘J IQ U>irj your your
your 1: α...... O ..... oο q <X ..... © ..... o • ta your. your <i4 yourpta: /: your : your your , £ <ra 1 CO your 02 your "®s your your © • Ή ·: your .....your..... œ. 1.1i1 ΚίΙ> · I ^s..... £> g ft S .ft ;. g<n *Λ ”.. KS ft • s sH f- ^: · vs¢ - gς >>XX gg theregh ** g ê 1: & 4 .....t * 4 · & KH your: : -W^: CJ : DO your P3 O 1 Κι Ki in Kl K;kt read fc & b your iu your 1 03 your your your your your your w (β your your ΕΏ your ft S3 w <Äf S3 S3 33 S3 your > 5 * 1 Yes S3 S3 s ; CO to your your your your your your " your co Μ > < > <. > + > 4 your.<+ î > 4 > 4 ! " -Ji · Ή . <-r>. >. ·. < ►H ΛΉ '«• s · yourEh& 4 Eh ..... <o your your your your your t.Q your IS) your your m ^h > > > V > Gold V * > > i> >>ö IQ0 < vs" Qî: <£ m · SE4 <:& Μ '03 to your..... your: iß your i®: < : / Μ O........... sgH < π ..... £ h Hsyour .your Ω Ω at..... sra < KT • ........... K] ..•K J : Μ . Kl: • your ....... i: ..... ...... / L /: ........ ............... </: q:.: XVΧ0Χ your H-: CO..... your your your s; ®:;: your your :: ³ ta ::> s® :::: •your your tt 03 your your s ^: ®; i your Eh ’EH:’ : <fâs Eh Eh ..... s® :: i g bd g g g g<* 1 g your g £> § fd iStt g-4 Ε * 4 Eh H Eh £ 4 Ebyour Eh £ - ( 1 0 Q Ο © your your o your your your your © 1 K * $ 5. & youryour S '. S> your1s 3 AT AT your f-1 your your your your r4 o i E-> Ε-ί Η Eh LH Eh friEh your your £ h yourH H Η Μ H 4-4 H l · -1 your :your H your your your- E-i ÊH £ Π Eh H tH H £ H & R L-4 youri " at AT HJ G your he R your your your your I sorting Eh Μ · K Eh > H4: E * 4 '.' 'rH. Eh youryour' 1 IF * $ 1 % & S3 S3 your £ • »* 4 • S4 £ your i n ₍S3G your £ L your your& your your your your 1K5 jd td y: Ή your : < 1 03 to your your your your your your your your your H f bd > 5. ' ££bd Μ your id o i Q Q Q Q o your your your O O your your your { O O Ο o o your your your rK • ^ f J * r> o Q your + g 2S, CD £ - * ζί your your K Yes your your your 1t-3W youryour fj your- your your your f> 4r ^H:v * 4 your > 4 b > 4 ’.> ' your your 1 > > > 5> > > > > > > P *1 O o- ; ΚΊ o o O O oi Ó o o at
1. LG CO to <0^r Q 03 CO <0 03 w C0 COf t> î> P > > > r- > > > >i: your HH bd H H EhW 1H t- < bH bd O : i ta your your g your S your your youryour your 1 ta Fy> bz your your-·00 co Μ " CO co üO --b ta W U your your your yourΜ Μ Kl bd ! your your your your <3 youryour Syour ft ! & 4 Eh E * i your L-4 E-4 your your H h Eh your ! Ó O O at o o: o at O o O at : ¢ 0 CO to <0 'O 03 <0 co Kl w CO CO : O Οί G o O ex o O O Yes Yes o < : EH E-4 your your F H H your your fri f-l your Eh : your your your your your your your" W your your O : £ L your 04 G Λ your G Gyou G Ch o :> < your l> t your > 4 > H your state >. > -1 > 1 your lO 4- ta your youryouryour Ft O <«! your F-m : <3 your CO Fl! your •• ta ^:your your Eh fr <yourHere Yes Qi Οΐ c: x Qi ..... tal ·your. ^:your: your H your G your your G Gyour> g ATi Sims: : ha. your your your itass : / qr Ο qr Qi: your your your your your your Vy your Μ fe5 your your1 C ft ftft ft ft ft ft ft! your your G g your your K your Cu Could g Ö4I) - ·: 1 * 4 H4 bH bH _w in your 3H Μ ^! S3s: s » S3 S3 & your IF $ your your1> i > 4 > 4 > 4 your your your > 4 your your! £ Èfe. £ your your your ε E & 4 your1 Vi CO to 03 03 CO <0 03 CO co1: L13 VJ "S 0 ΡΊ OO © 0 O Ói: m your your your your your your your your your O i> > î> > > >4>> > I-.K O 1 E-i tH Eh Eh Eh your your Eh E- · your 0 ^ i ta your your g your < ft your your < f- · i m Ki your your your your your your your your SJ « 4 ta your your your your your your your g g your<G -i- ® CO CO 03 03 CO CO 03youri hey your your your £ 4 H your your E-. E. your your.1 K JSÏ2 £25 £ • “eS 221 ta yourta ^:»> 4 bn your • / H > ’ 1 ÎH AT Eh tH Eh your your your Eh Eh1 ta your 04: W / << your · :. your your. . : ta 'iyour i; ": ft · ft• ft ^;ft at at at Oί your your EH: your Eh yourH E’4 H your E- ‘1 Κι your IXf H-t Kl your your K4 Kii:: ta Ata: ' your Vf & V your your Oe ..... 0 VCQ: 1 OEh {Q Eh your your Eh E-î Ehi: ..... your your ^•your.;' , î3 + -Kl: · your..... ifrl ·: ·· spq ::: :: <KT ^:ATi m your your your AT your: your:/ your your yourî: Eh your your E-1 Ε-4 Eh E-i your your... e-. your your1 Sir '; _: / ta: · ii'tH s: ......... :your/: 25 &: s: · ^ :: 22i 03 00CO 03 03 tal ......... : ’'Tav': ::: Ω :: CO Gi • ft 1^: s ^ s: : W < ^:<< ftu ft : -ta > sta '< Sr ^ SS ) H: r ta your your your ta: youryour : G </ W: :: G <+ Gi> * > 4 > 4 your your > 4 > 4 your your > -tr- *to r · -.1O LOroÖ ' KF to ï ~ H o r — 4 Ή <NinC0 G * · σ> your o rH Cj"H < ^v 4 ’Ö rH rHvH your 01 O)”3rH ^:(Ό+ H "H Ο1 your your your your TJ your Ί5 τι T τ> ¹ T T your Tft T T T T5 T T Tyour your rî youryour your your your ft $ • 4 P <f < t t rt ft ft ft ft ft ft $at X3.d at > d > u ►d æ& 'fi t X3 T d ft X3 AT d i "·©Q o,°. Q Q, υ o. youri yourt G j F Ho O _ryour Q o, ° | Ο O|: o t vs"your + H ' 1VH T> ‘ 1 IG kG ’ your ‘ 103 t ςΤ < i o vHta ^: ' r-4 Μ ' < ^v ' xr f LO Φ 1 ta tyour your iW: o Q o o O o Q O O vH r-Hr ~ i 0 o O o O Q O o o
133
BE2017 / 5910 tee summer tee
Ή: r * a. <ÿ you you you you0 you ZD you you you you you you 0 & £ 3 you you VS* • ^; £ X you you youQ & | you tee ^: you you you; you Ö <1 < VS'H Ö ft tee. you1 where 1 tee you; you
134
BE2017 / 5910

类似技术:

---

公开号 | 公开日 | 专利标题

---

BE1024420B1|2018-02-19|POLYNUCLEOTIDES AND POLYPEPTIDES OF ADENOVIRUS

---

BE1025029B1|2018-10-10|POLYNUCLEOTIDES AND POLYPEPTIDES OF ADENOVIRUS

---

US20210060150A1|2021-03-04|Novel adenovirus

---

BE1024774B1|2018-07-02|COMPOSITIONS AND METHODS OF TREATMENT

---

US20210269486A1|2021-09-02|Chimpanzee adenovirus constructs with lyssavirus antigens

---

US20210246468A1|2021-08-12|Adenovirus polynucleotides and polypeptides

---

BE1024824B1|2018-07-13|POLYNUCLEOTIDES AND POLYPEPTIDES OF ADENOVIRUS

同族专利:

---

公开号 | 公开日

---

CN110300597A|2019-10-01|

---

GB201620968D0|2017-01-25|

---

US20190300905A1|2019-10-03|

---

EA201991116A1|2019-12-30|

---

MX2019006725A|2019-08-22|

---

BE1025029A1|2018-10-02|

---

JP2020511114A|2020-04-16|

---

KR20190092471A|2019-08-07|

---

BR112019010906A2|2019-10-01|

---

IL266942D0|2019-07-31|

---

AR110502A1|2019-04-03|

---

CA3045973A1|2018-06-14|

---

WO2018104911A1|2018-06-14|

---

EP3551224A1|2019-10-16|

---

AU2017371944B2|2020-07-02|

---

AU2017371944A1|2019-06-20|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

WO2005071093A2|2004-01-23|2005-08-04|Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa|Chimpanzee adenovirus vaccine carriers|

---

WO2016198621A1|2015-06-12|2016-12-15|Glaxosmithkline Biologicals Sa|Adenovirus polynucleotides and polypeptides|

---

US4436727A|1982-05-26|1984-03-13|Ribi Immunochem Research, Inc.|Refined detoxified endotoxin product|

---

CA1331443C|1987-05-29|1994-08-16|Charlotte A. Kensil|Saponin adjuvant|

---

US5057540A|1987-05-29|1991-10-15|Cambridge Biotech Corporation|Saponin adjuvant|

---

US5240846A|1989-08-22|1993-08-31|The Regents Of The University Of Michigan|Gene therapy vector for cystic fibrosis|

---

EP0468520A3|1990-07-27|1992-07-01|Mitsui Toatsu Chemicals, Inc.|Immunostimulatory remedies containing palindromic dna sequences|

---

JP3723231B2|1991-12-23|2005-12-07|ディミナコアクチェンゲゼルシャフト|Adjuvant|

---

CA2138997C|1992-06-25|2003-06-03|Jean-Paul Prieels|Vaccine composition containing adjuvants|

---

EP0812593B8|1993-03-23|2010-11-10|SmithKline Beecham Biologicals S.A.|Vaccine compositions containing 3-0 deacylated monophosphoryl lipid a|

---

CA2175375C|1993-11-17|2010-01-05|John Gwynfor Davies|Glucosamine disaccharides, method for their preparation, pharmaceutical composition comprising same, and their use|

---

GB9326253D0|1993-12-23|1994-02-23|Smithkline Beecham Biolog|Vaccines|

---

DK0772619T4|1994-07-15|2011-02-21|Univ Iowa Res Found|Immunomodulatory oligonucleotides|

---

AUPM873294A0|1994-10-12|1994-11-03|Csl Limited|Saponin preparations and use thereof in iscoms|

---

DE69637254T2|1995-04-25|2008-06-19|Glaxosmithkline Biologicals S.A.|Vaccines containing a saponin and a sterol|

---

US6083716A|1996-09-06|2000-07-04|The Trustees Of The University Of Pennsylvania|Chimpanzee adenovirus vectors|

---

IL128780D0|1996-09-06|2000-01-31|Univ Pennsylvania|An inducible method for production of recombinant adeno-associated viruses utilizing T7 polymerase|

---

GB9620795D0|1996-10-05|1996-11-20|Smithkline Beecham Plc|Vaccines|

---

JP4111403B2|1996-10-11|2008-07-02|ザリージェンツオブザユニバーシティーオブカリフォルニア|Immunostimulatory polynucleotide / immunomodulatory molecule complex|

---

US6303347B1|1997-05-08|2001-10-16|Corixa Corporation|Aminoalkyl glucosaminide phosphate compounds and their use as adjuvants and immunoeffectors|

---

US6113918A|1997-05-08|2000-09-05|Ribi Immunochem Research, Inc.|Aminoalkyl glucosamine phosphate compounds and their use as adjuvants and immunoeffectors|

---

US6764840B2|1997-05-08|2004-07-20|Corixa Corporation|Aminoalkyl glucosaminide phosphate compounds and their use as adjuvants and immunoeffectors|

---

GB9711990D0|1997-06-11|1997-08-06|Smithkline Beecham Biolog|Vaccine|

---

ES2500490T3|1997-08-29|2014-09-30|Antigenics Inc.|Compositions comprising adjuvant QS-21 and polysorbate or cyclodextrin as excipient|

---

EP1009382B1|1997-09-05|2003-06-18|GlaxoSmithKline Biologicals S.A.|Oil in water emulsions containing saponins|

---

GB9718901D0|1997-09-05|1997-11-12|Smithkline Beecham Biolog|Vaccine|

---

WO2000011140A1|1998-08-20|2000-03-02|The Wistar Institute Of Anatomy And Biology|Methods of augmenting mucosal immunity through systemic priming and mucosal boosting|

---

CN100558401C|1998-10-16|2009-11-11|史密丝克莱恩比彻姆生物有限公司|Adjuvant system and vaccine|

---

US7291498B2|2003-06-20|2007-11-06|The Trustees Of The University Of Pennsylvania|Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses|

---

WO2007062656A2|2005-11-30|2007-06-07|Copenhagen University|A nucleotide vaccine|

---

EP2181121A4|2007-03-21|2012-07-11|Id Biomedical Corp Quebec|Chimeric antigens|

---

CN102292102A|2008-11-21|2011-12-21|哥本哈根大学|Priming of an immune response|

---

CN102300872A|2009-02-02|2011-12-28|奥凯罗斯股份公司|Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof|

---

WO2012089231A1|2010-12-30|2012-07-05|Okairòs Ag|Paramyxovirus vaccines|

---

EP2678433B1|2011-02-22|2017-05-03|California Institute of Technology|Delivery of proteins using adeno-associated virus vectors|CA3115891A1|2013-03-14|2014-09-25|Salk Institute For Biological Studies|Oncolytic adenovirus compositions|

---

JP2019506877A|2016-02-23|2019-03-14|ソーク インスティテュート フォー バイオロジカル スタディーズ|High-throughput assay for measuring adenovirus replication kinetics|

---

EP3655536A1|2017-07-17|2020-05-27|GlaxoSmithKline Biologicals SA|Lyssavirus antigen constructs|

---

WO2019239311A1|2018-06-12|2019-12-19|Glaxosmithkline Biologicals Sa|Adenovirus polynucleotides and polypeptides|

---

WO2020030572A1|2018-08-07|2020-02-13|Glaxosmithkline Biologicals Sa|Processes and vaccines|

---

EP3897846A1|2018-12-21|2021-10-27|GlaxoSmithKline Biologicals SA|Methods of inducing an immune response|

---

CA3140019A1|2019-05-30|2020-12-03|Gritstone Bio, Inc.|Modified adenoviruses|

法律状态:
2018-11-29| FG| Patent granted|Effective date: 20181010 |

---

2020-08-27| MM| Lapsed because of non-payment of the annual fee|Effective date: 20191231 |

优先权:

---

申请号 | 申请日 | 专利标题

---

GB1620968.6|2016-12-09|

---

GBGB1620968.6A|GB201620968D0|2016-12-09|2016-12-09|Adenovirus polynucleotides and polypeptides|

---